Prev. |  KEGG KO K02176 > 

RIKEN DNA Bank Human Resource - SFRP2

Gene ID NCBI Gene 6423 |  KEGG hsa:6423
Gene Symbol SFRP2
Protein Name secreted frizzled related protein 2
Synonyms FRP-2|SARP1|SDF-5
Ortholog resources KEGG ortholog (KEGG orthology K02176) in the DNA Bank
Featured content Wnt signaling pathway (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005513 IRAK013N01 pCMV-SPORT6 BC008666 NM_003013 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE046362 W01A115P02 pENTR-TOPO IRAK013N01 BC008666 NM_003013  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR322458 RBb06C10 pKA1U5 NM_003013.2  
GATTCTGCTCCCCCGGGTCGGAGCCCCCCGGAGCTGCGCGCGGGCTTGCAGCGCCTCGCC
HKR329375 RBb23H07 pGCAP1 NM_003013.2  
ATTCTGCTCCCCCGGGGTCGGAAGCCCCCCGGAGCTGCGCGCGGGCTTGCAGCGCCTCGC
HKR339678 RBb49D06 pGCAP1 NM_003013.2  
GCCCCAGCAACGGCTCATTCTGCTCCCCCGGGTCGGAGCCCCCCGGTAGCTGCGCGCGGG
HKR341207 RBb53A07 pGCAP1 NM_003013.2  
GGCCCCAGACAACAGCTCATTCTGCTCCCCCGGGTTCNNATCCCCCCGGAAGCTGCGCGC
HKR369608 RBd24A08 pGCAP10 NM_003013.2  
TGGCCCCAGCAACGGCTCATTCTGCTCCCCCGGGTCGGAGCCCCCCGGAGCTGCGCGCGG
HKR373607 RBd34A07 pGCAP10 NM_003013.2  
GATTCTGCTCCCCCGGGTCGGAGCCCCCCGGAGCTGCGCGCGGGCTTGCAACGCCTCGCC
HKR374898 RBd37E02 pGCAP10 NM_003013.2  
GGCCCCAGCAACGGCTCATTCTGCTCCCCCGGGTCGGAGCCCCCCGGAGCTGCGCGCGGG
HKR388551 RBd71G07 pGCAP10 NM_003013.2  
GATTCTGCTCCCCCGGGTCGGAGCCCCCCGGAGCTGCGCGCGGGCTTGCAGCGCCTCGCC
HKR396084 RBd90D12 pGCAP10 NM_003013.2  
GATTCTGCTCCCCCGGGTCGGAGCCCCCCGGAGCTGCGCGCGGGCTTGCAGCGCCTCGCC
HKR405370 RBdS013H02 pGCAP10 NM_003013.2  
GATTCTGCTCCCCCGGGTCGGAGCCCCCCGGAGCTGCGCGCGGGCTTGCAGCGCCTCGCC
HKR406147 RBdS015G03 pGCAP10 NM_003013.2  
GGCCCCAGCAACGGCTCATTCTGCTCCCCCGGGTCGGAGCCCCCCGGAGCTGCGCGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl