Prev. |  KEGG KO K06840 > 

RIKEN DNA Bank Human Resource - SEMA3F

Gene ID NCBI Gene 6405 |  KEGG hsa:6405
Gene Symbol SEMA3F
Protein Name semaphorin 3F
Synonyms SEMA-IV|SEMA4|SEMAK
Ortholog resources KEGG ortholog (KEGG orthology K06840) in the DNA Bank
Featured content Axon guidance - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY097886 IRAL044L22 pOTB7 BC042914 NM_004186

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR333674 RBb34D02 pGCAP1 NM_004186.3  
GAGACCAGAGCGAGCGAACGAACCGCGGCGGTCCGGAGAGCCNTTAGCGCAGCGCAGGAC
HKR363729 RBd09F09 pGCAP10 NM_004186.3  
GAATTGCCGGCGCTCCCCGCGCGGCTCTGAGCGCCCCGTCCCGCCGGCGGCCGCGAGACC
HKR371229 RBd28B05 pGCAP10 NM_004186.3  
GGAGCGCCCCGTCCCGCCGGCGGCCGCGAGACCAGAGCGAGCGAACGAACCGCGGCGGTC
HKR432617 RBdS081J01 pGCAP10 NM_004186.3  
HKR442336 RBdS105N24 pGCAP10 NM_004186.3  
GGCGAGCGAACGAACCGCGGCGGTCCGGAGAGCCCCGAGCGCAGCGCAGGACCTGGGTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl