Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SEMA3F

Gene ID (NCBI) 6405
Gene Symbol SEMA3F
Protein Name semaphorin 3F
Synonyms SEMA-IV|SEMA4|SEMAK
Databases KEGG hsa:6405 |  NCBI Gene 6405
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06840)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY097886 IRAL044L22 pOTB7 BC042914 NM_004186

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR363729 RBd09F09 pGCAP10 NM_004186.3  
GAATTGCCGGCGCTCCCCGCGCGGCTCTGAGCGCCCCGTCCCGCCGGCGGCCGCGAGACC
HKR371229 RBd28B05 pGCAP10 NM_004186.3  
GGAGCGCCCCGTCCCGCCGGCGGCCGCGAGACCAGAGCGAGCGAACGAACCGCGGCGGTC
HKR333674 RBb34D02 pGCAP1 NM_004186.3  
GAGACCAGAGCGAGCGAACGAACCGCGGCGGTCCGGAGAGCCNTTAGCGCAGCGCAGGAC
HKR432617 RBdS081J01 pGCAP10 NM_004186.3  
HKR442336 RBdS105N24 pGCAP10 NM_004186.3  
GGCGAGCGAACGAACCGCGGCGGTCCGGAGAGCCCCGAGCGCAGCGCAGGACCTGGGTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.02.22

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl