Prev. | 

RIKEN DNA Bank Human Resource - SEC14L1

Gene ID NCBI Gene 6397 |  KEGG hsa:6397
Gene Symbol SEC14L1
Protein Name SEC14 like lipid binding 1
Synonyms PRELID4A|SEC14L
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR188010 ARi70A10 pGCAP10 NM_003003.2  
GCTCCCCGGCCCCCTCCCCGGAACCGGCGGTCGAGCTACGGTCGCGGAGCAGTGGAACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl