Prev. |  KEGG KO K00237 > 

RIKEN DNA Bank Human Resource - SDHD

Gene ID NCBI Gene 6392 |  KEGG hsa:6392
Gene Symbol SDHD
Protein Name succinate dehydrogenase complex subunit D
Synonyms CBT1|CII-4|CWS3|PGL|PGL1|QPs3|SDH4|cybS
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Ortholog resource in our bank

  SDHD

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086769 IRAL016P09 pDNR-LIB BC005263 NM_003002 Full
HGY087731 IRAL019F11 pDNR-LIB BC012603 NM_003002 Full
HGY088603 IRAL021I11 pDNR-LIB BC009574 NM_003002 Full
HGY088710 IRAL021M22 pDNR-LIB BC015188 NM_003002 Full
HGY094214 IRAL035I22 pDNR-LIB BC022350 NM_003002 Full
HGY095237 IRAL038B13 pDNR-LIB BC015992 NM_003002 Full
HGY102826 IRAL057B02 pDNR-LIB BC070307 NM_003002 Full/var
HGY102966 IRAL057G22 pDNR-LIB BC071755 NM_003002 Full
HGY103002 IRAL057I10 pDNR-LIB BC071756 NM_003002 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE013396 W01A033I04 pENTR-TOPO IRAL016P09 BC005263 NM_003002  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR071274 ARe78D02 pKA1U5 NM_003002.2  
GAGGAACGAGATGGCGGTTCTCTGGAGGCTGAGTGCCGTTTGCGGTGCCCTAGGAGGCCG
HKR163706 ARi09E10 pGCAP10 NM_003002.2  
GAGCCCTCAGGAACGAGATGGCGGTTCTCTGGAGGCTGAGTGCCGTTTGCGGTGCCCTAG
HKR218148 ARiS045G04 pGCAP10 NM_003002.2  
GCTCANGANCGAGATGGCGGTTCTCTGGAGGCTGAGTGCCGTTTGCGGTGCCCTAGGAGG
HKR346130 RBb65F10 pGCAP1 NM_003002.2  
GGGGTTGGTGGATGACCTTGAGCCCTCAGGAACGAGATGGCGGTTCTCTGGAGGCTGAGT
HKR368573 RBd21H05 pGCAP10 NM_003002.2  
GAGGAANGAGATGGCGGTTCTCTGGAGGCTGAGTGCCGTTTGCGGTGCCCTAGGAGGCCG
HKR420588 RBdS051H20 pGCAP10 NM_003002.2  
GAGGAACGAGATGGCGGTTCTCTGGAGGCTGAGTGCCGTTTGCGGTGCCCTAGGAGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl