Prev. |  KEGG KO K00236 > 

RIKEN DNA Bank Human Resource - SDHC

Gene ID NCBI Gene 6391 |  KEGG hsa:6391
Gene Symbol SDHC
Protein Name succinate dehydrogenase complex subunit C
Synonyms CYB560|CYBL|PGL3|QPS1|SDH3
Ortholog resources KEGG ortholog (KEGG orthology K00236) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025962 IRAK064P02 pCMV-SPORT6 BC033626 NM_003001 Full
HGY067355 IRAK168G11 pBluescriptR BC066329 NM_003001 Full
HGY094442 IRAL036B18 pDNR-LIB BC020808 NM_003001 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE036195 W01A090I03 pENTR-TOPO IRAL036B18 BC020808 NM_003001  
HGE036197 W01A090I05 pENTR-TOPO IRAL036B18 BC020808 NM_003001  
HGE036203 W01A090I11 pENTR-TOPO IRAL036B18 BC020808 NM_003001  
HGE036211 W01A090I19 pENTR-TOPO IRAL036B18 BC020808 NM_003001  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058049 ARe45C01 pKA1U5 NM_003001.3  
GAGACCGGAACCCAAGATGGCTGCGCTGTTGCTGAGACACGTTGGTCGTCATTGCCTCCG
HKR072970 ARe82H02 pKA1U5 NM_003001.3  
GAGACCGGAACCCAAGATGGCTGCGCTGTTGCTGAGACACGTTGGTCGTCATTGCCTCCG
HKR074505 ARe86E09 pKA1U5 NM_003001.3  
GACTTCCGTCCAGACCGGAACCCAAGATGGCTGCGCTGTTGCTGAGACACGTTGGTCGTC
HKR079273 ARe98D01 pKA1U5 NM_003001.3  
GTCCGTCCAGACCGGAACCCAAGATGGCTGCGCTGTTGCTGAGACACGTTGGTCGTCATT
HKR169657 ARi24C09 pGCAP10 NM_003001.3  
GACTTCCGTCCAGACCGGAACCCAAGATGGCTGCGCTGTTGCTGAGACACGTTGGTCGTC
HKR176810 ARi42A10 pGCAP10 NM_003001.3  
GAGACCGGAACCCAAGATGGCTGCGCTGTTGCTGAGACACGTTGGTCGTCATTGCCTCCG
HKR184174 ARi60H06 pGCAP10 NM_003001.3  
GACTTCCGTCCAGACCGGAACCCAAGATGGCTGCGCTGTTGCTGAGACACGTTGGTCGTC
HKR330475 RBb26D03 pGCAP1 NM_003001.3  
GACTTCCGTCCAGACCGGAACCCAAGATGGCTGCGCTGTTGCTGAGACACGTTGGTCGTC
HKR338108 RBb45E12 pGCAP1 NM_003001.3  
GTCACTTCCGTCCAGACCGGAACCCAAGATGGCTGCGCTGTTGCTGAGACACGTTGGTCG
HKR394011 RBd85A11 pGCAP10 NM_003001.3  
TTACTTCCGTCCAGACCGGAACCCAAGATGGCTGCGCTGTTGCTGAGACACGTTGGTCGT
HKR461650 RBdS154C02 pGCAP10 NM_003001.3  
TGACTTCCGTCCAGACCGGAACCCAAGATGGCTGCGCTGTTGCTGAGACACGTTGGTCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl