Prev. |  KEGG KO K00235 > 

RIKEN DNA Bank Human Resource - SDHB

Gene ID NCBI Gene 6390 |  KEGG hsa:6390
Gene Symbol SDHB
Protein Name succinate dehydrogenase complex iron sulfur subunit B
Synonyms CWS2|IP|PGL4|SDH|SDH1|SDH2|SDHIP
Ortholog resources KEGG ortholog (KEGG orthology K00235) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088106 IRAL020E10 pOTB7 BC007840 NM_003000 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014214 W01A035I22 pENTR-TOPO IRAL020E10 BC007840 NM_003000  
HGE014216 W01A035I24 pENTR-TOPO IRAL020E10 BC007840 NM_003000  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044545 ARe11G01 pKA1U5 NM_003000.2  
ATCCTGGAGGAGCCAAGATGGCGGCGGTGGTCGCACTCTCCTTGAGGCGCCGGTTGCCGG
HKR074077 ARe85D05 pKA1U5 NM_003000.2  
GCTCAGTGGATGTAGGCTGGGCGCCGCGATGTTCGACGGGACACCGGCGGAGAGCGACCT
HKR172507 ARi31E11 pGCAP10 NM_003000.2  
GAGGAGCCAAGATGGCGGCGGTGGTCGCACTCTCCTTGAGGCGCCGGTTGCCGGCCACAA
HKR235069 ARiS087L05 pGCAP10 NM_003000.2  
GGCTGACGTCAGGAGCCAAGATGGCGGCGGTGGTCGCACTCTCCTTGAGGCGCCGGTTGC
HKR247476 ARiS118L12 pGCAP10 NM_003000.2  
GAGGAGCCAAGATGGCGGCGGTGGTCGCACTCTCCTTGAGGCGCCGGTTGCCGGCCACAA
HKR333275 RBb33D03 pGCAP1 NM_003000.2  
GGTCAGGAGCCAAGATGGCGGCGGTGGTCGCACTCTCCTTGAGGCGCCGGTTGCCGGCCA
HKR346951 RBb67G07 pGCAP1 NM_003000.2  
GGGGGCTGACGTCAGGAGCCAAGATGGCGGCGGTGGTCGCACTCTCCTTGAGGCGCCGGT
HKR368927 RBd22F07 pGCAP10 NM_003000.2  
HKR372029 RBd30B05 pGCAP10 NM_003000.2  
GGTCAGGAGCCAAGATGGCGGCGGTGGTCGCACTCTCCTTGAGGCGCCGGTTGCCGGCCA
HKR416090 RBdS040D18 pGCAP10 NM_003000.2  
NGAGNNNCNNNNNNNNNNGATNGGCGGCGGTGGTCGCACTCTCCTTGAGGCGCCGGTTGC
HKR420468 RBdS051C20 pGCAP10 NM_003000.2  
GGGGGCTGACGTCAGGAGCCAAGATGGCGGCGGTGGTCGCACTCTCCTTGAGGCGCCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl