Prev. |  KEGG KO K00234 > 

RIKEN DNA Bank Human Resource - SDHA

Gene ID NCBI Gene 6389 |  KEGG hsa:6389
Gene Symbol SDHA
Protein Name succinate dehydrogenase complex flavoprotein subunit A
Synonyms CMD1GG|FP|PGL5|SDH1|SDH2|SDHF
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Ortholog resource in our bank

  SDHA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081807 IRAL004I15 pOTB7 BC001380 NM_004168 Full/var
HGY097603 IRAL044A03 pOTB7 BC041016 NM_004168 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE016315 W01A040N03 pENTR-TOPO IRAL004I15 BC001380 NM_004168  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR377280 RBd43D08 pGCAP10 NM_004168.2  
GAGTCTGCGCAGGGACTGGCGGGACTGCGCGGCGGCAACAGCAGACATGTCGGGGGTCCG
HKR379235 RBd48B11 pGCAP10 NM_004168.2  
GGGGACTGGCGGGACTGCGCGGCGGCAACAGCAGACATGTCGGGGGTCCGGGGCCTGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl