Prev. |  KEGG KO K17254 > 

RIKEN DNA Bank Human Resource - SDCBP

Gene ID NCBI Gene 6386 |  KEGG hsa:6386
Gene Symbol SDCBP
Protein Name syndecan binding protein
Synonyms MDA-9|MDA9|ST1|SYCL|TACIP18
Ortholog resource in our bank

  SDCBP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07638 pcDNA3-hSyntenin

webcatalog20220516.tab


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021667 W01A054C19 pENTR-TOPO flj0075f06 AK128645 NM_005625  
HGE021669 W01A054C21 pENTR-TOPO flj0075f06 AK128645 NM_005625  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043323 ARe08F03 pKA1U5 NM_005625.3  
GAGTGACCGGAGGCGGCGGCGGCGAGCGGTTCCTTGTGGGCTAGAAGAATCCTGCAAAAA
HKR052829 ARe32B05 pKA1U5 NM_005625.3  
GAGTGACCGGAGGCGGCGGCGGCGAGCGGTTCCTTGTGGGCTAGAAGAATCCTGCAAAAA
HKR062005 ARe55A05 pKA1U5 NM_005625.3  
GAGTGACCGGAGGCGGCGGCGGCGAGCGGTTCCNTGTTGGGCTAGAAGAATCCTGCAAAA
HKR205571 ARiS013P11 pGCAP10 NM_005625.3  
GAGTGACCGGAGGCGGCGGCGGCGAGCGGTTCCTTGTGGGCTAGAAGAATCCTGCAAAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl