Prev. |  KEGG KO K16336 > 

RIKEN DNA Bank Human Resource - SDC2

Gene ID NCBI Gene 6383 |  KEGG hsa:6383
Gene Symbol SDC2
Protein Name syndecan 2
Synonyms CD362|HSPG|HSPG1|SYND2
Ortholog resource in our bank

  SDC2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037305 IRAK093E09 pCMV-SPORT6 BC049836 NM_002998 Full/var
HGY090699 IRAL026M11 pOTB7 BC030133 NM_002998 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064455 ARe61C07 pKA1U5 NM_002998.3  
GGAGGAGGGTTCGCACCCGACGCTAGCCANTGAGCCCCTTTTGGACGCGCTGCTCTCCAG
HKR174123 ARi35F03 pGCAP10 NM_002998.3  
GGGGGCGCAGCCGCGGAGCCAGTGGCCCCGCTTGGACGCGCTGCTCTCCAGATACCCCCG
HKR375304 RBd38E08 pGCAP10 NM_002998.3  
GGGAGGGGCGCAGCCGCGGAGCCAGTGGCCCCGCTTGGACGCGCTGCTCTCCAGATACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl