Prev. |  KEGG KO K14624 > 

RIKEN DNA Bank Human Resource - CCL2

Gene ID NCBI Gene 6347 |  KEGG hsa:6347
Gene Symbol CCL2
Protein Name C-C motif chemokine ligand 2
Synonyms GDCF-2|HC11|HSMCR30|MCAF|MCP-1|MCP1|SCYA2|SMC-CF
Featured content SARS-CoV-2 relevant human genes
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  CCL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005937 IRAK014O01 pCMV-SPORT6 BC009716 NM_002982 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE003860 W01A009K20 pENTR-TOPO IRAK014O01 BC009716 NM_002982  
HGE003862 W01A009K22 pENTR-TOPO IRAK014O01 BC009716 NM_002982  
HGE003864 W01A009K24 pENTR-TOPO IRAK014O01 BC009716 NM_002982  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041371 ARe03H03 pKA1U5 NM_002982.3  
GGAGAGGCTGAGACTAACCCAGAAACATCCAATTCTCNAACTGAAGCTCGCACTCTCGCC
HKR049780 ARe24H12 pKA1U5 NM_002982.3  
GCGAGAGGCTGAGACTAACCCAGAAACATCCAATTCTCAAACTGAAGCTCGCACTCTCGC
HKR264521 ARiS161F01 pGCAP10 NM_002982.3  
TTGTTTNTTGNTGNGAAAACNNTATNNCCAAAAATAATGGGNNNCCCCCNNTTNNGGNNN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl