Prev. |  KEGG KO K07152 > 

RIKEN DNA Bank Human Resource - SCO1

Gene ID NCBI Gene 6341 |  KEGG hsa:6341
Gene Symbol SCO1
Protein Name synthesis of cytochrome C oxidase 1
Synonyms SCOD1
Ortholog resource in our bank

  SCO1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX009095 IRAK022M07 pCMV-SPORT6 BC015504 NM_004589 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205375 ARiS013H07 pGCAP10 NM_004589.2  
GGGAGACCCGGTCTCCGAGGCTCATGGCGATGCTGGTCCTAGTACCCGGACGAGTTATGC
HKR247363 ARiS118G19 pGCAP10 NM_004589.2  
GGGCTCATGNNGATGCTGGNCCTAGTACCCGGACGAGTTATGCGGCCTCTGGGTGGCCAA
HKR320925 RBb02F05 pKA1U5 NM_004589.2  
GGCGGGGAGGGTCAAAGGAGACCCGGTCTCCGAGGCTCATGGCGATGCTGGTCCTAGTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl