Prev. | 

RIKEN DNA Bank Human Resource - ATXN2

Gene ID NCBI Gene 6311 |  KEGG hsa:6311
Gene Symbol ATXN2
Protein Name ataxin 2
Synonyms ATX2|SCA2|TNRC13
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014003 W01A035A03 pENTR-TOPO flj0075j21 AK128613 NM_002973  
HGE014005 W01A035A05 pENTR-TOPO flj0075j21 AK128613 NM_002973  
HGE014007 W01A035A07 pENTR-TOPO flj0075j21 AK128613 NM_002973  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR363726 RBd09F06 pGCAP10 NM_002973.3  
GGGCAGAGCTCGCCTCCCTCCGCCTCAGACTGTTTTGGTAGCAACGGCAACGGCGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl