Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATXN2

Gene ID (NCBI) 6311
Gene Symbol ATXN2
Protein Name ataxin 2
Synonyms ASL13|ATX2|SCA2|TNRC13
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014003 W01A035A03 pENTR-TOPO flj0075j21 AK128613 NM_002973  
HGE014005 W01A035A05 pENTR-TOPO flj0075j21 AK128613 NM_002973  
HGE014007 W01A035A07 pENTR-TOPO flj0075j21 AK128613 NM_002973  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR363726 RBd09F06 pGCAP10 NM_002973.3  
GGGCAGAGCTCGCCTCCCTCCGCCTCAGACTGTTTTGGTAGCAACGGCAACGGCGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl