Prev. |  KEGG KO K18061 > 

RIKEN DNA Bank Human Resource - SBF1

Gene ID NCBI Gene 6305 |  KEGG hsa:6305
Gene Symbol SBF1
Protein Name SET binding factor 1
Synonyms CMT4B3|DENND7A|MTMR5
Ortholog resource in our bank

  SBF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX043115 IRAK107N03 pCMV-SPORT6 BC046169 NM_002972 Partial
HGX047877 IRAK119L13 pCMV-SPORT6 BC056915 NM_002972 Partial/var
HGY088938 IRAL022F18 pOTB7 BC009268 NM_002972 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219765 ARiS049G21 pGCAP10 NM_002972.1  
GGGGCGGGCCGGCTGGCTGGNAANATGGNNGAAANNATTNTCNNNGGNNNTTTNGNNTTT
HKR372098 RBd30E02 pGCAP10 NM_002972.1  
GGGGCGGGCCGGCTGGCTGGGAAGATGGCGGCGGGAGCCTGGGCCGCCGCCGCCGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl