Prev. |  KEGG KO K00657 > 

RIKEN DNA Bank Human Resource - SAT1

Gene ID NCBI Gene 6303 |  KEGG hsa:6303
Gene Symbol SAT1
Protein Name spermidine/spermine N1-acetyltransferase 1
Synonyms DC21|KFSD|KFSDX|SAT|SSAT|SSAT-1
Ortholog resource in our bank

  SAT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081757 IRAL004G13 pOTB7 BC002503 NM_002970 Full
HGY088639 IRAL021J23 pDNR-LIB BC008424 NM_002970 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045678 ARe14D06 pKA1U5 NM_002970.1  
GCGCAGCTCTTAGTCGCGGGCTGACTGGTGTTTATCCGTCACTCGCCGAGGTTCCTTGGG
HKR068051 ARe70C03 pKA1U5 NM_002970.1  
TGGCGCAGCTCTTAGTCGCGGGCTGACTGGTGTTTATCCGTCACTCGCCGAGGTTCCTTG
HKR243735 ARiS109F15 pGCAP10 NM_002970.1  
GGCGCANCTCTTAGTCGCGGGCTGACTGGTGTTTATCCGTCACTCGCCGAGGTTCCTTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.07.20

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl