Prev. | 

RIKEN DNA Bank Human Resource - S100A13

Gene ID NCBI Gene 6284 |  KEGG hsa:6284
Gene Symbol S100A13
Protein Name S100 calcium binding protein A13
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082077 IRAL005D05 pOTB7 BC000632 NM_005979 Full
HGY101782 IRAL054H14 pOTB7 BC068064 NM_005979 Full
HGY103095 IRAL057M07 pDNR-LIB BC070291 NM_005979 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060098 ARe50E02 pKA1U5 NM_005979.2  
GCTCTCCTCCTTCCCCGCTGCTTATAAACCTCAGCCCTGAGGCTCCAGCTCACTCTACCC
HKR167778 ARi19H10 pGCAP10 NM_005979.2  
GGCTTATAAACCTCAGCCCTGAGGCTCCAGCTCACTCTACCCCATCTCCTTGCCGGGTCA
HKR176902 ARi42E06 pGCAP10 NM_005979.2  
GACTCTACCCCATCTCCTTGCCGGGTCAGCCCTGACAAAGGTCAGCTAGCCCCTTGAGGA
HKR330500 RBb26E04 pGCAP1 NM_005979.2  
CTCACTCTACCCCATCTCCTTGCCGGGTCAGCCCTGACAAAGGTCAGCTAGCCCCTTGAG
HKR332836 RBb32B12 pGCAP1 NM_005979.2  
HKR433214 RBdS083A14 pGCAP10 NM_005979.2  
GGCTTATAAACCTCAGCCCTGAGGCTCCAGCTCACTCTACCCCATCTCCTTGCCGGGTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl