Prev. |  KEGG KO K02947 > 

RIKEN DNA Bank Human Resource - RPS10

Gene ID NCBI Gene 6204 |  KEGG hsa:6204
Gene Symbol RPS10
Protein Name ribosomal protein S10
Synonyms DBA9|S10
Ortholog resources KEGG ortholog (KEGG orthology K02947) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081606 IRAL004A06 pOTB7 BC001032 NM_001014 Full
HGY083956 IRAL009O20 pOTB7 BC001955 NM_001014 Full
HGY085232 IRAL013B08 pOTB7 BC005012 NM_001014 Full
HGY103013 IRAL057I21 pDNR-LIB BC070235 NM_001014 Full
HGY103368 IRAL058G24 pOTB7 BC073799 NM_001014 Full
HGY103469 IRAL058L05 pOTB7 BC071946 NM_001014 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041356 ARe03G12 pKA1U5 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR042081 ARe05D09 pKA1U5 NM_001014.3  
TCCTTCTTTTCCAGCCCCGGATACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGA
HKR042132 ARe05F12 pKA1U5 NM_001014.3  
GCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTGCCA
HKR044855 ARe12C07 pKA1U5 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR045227 ARe13B03 pKA1U5 NM_001014.3  
GCTTTTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAG
HKR046879 ARe17D07 pKA1U5 NM_001014.3  
TGACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTGCCATTTAT
HKR049769 ARe24H01 pKA1U5 NM_001014.3  
TGGAGGCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGA
HKR058831 ARe47B07 pKA1U5 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR059278 ARe48D06 pKA1U5 NM_001014.3  
GAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTG
HKR063746 ARe59G02 pKA1U5 NM_001014.3  
GGCAGAGGTGAGTTTCTGTGGCGTTCGAGTTCCATCGGCTCCCATCCGGGCTATCCTGCC
HKR066497 ARe66E01 pKA1U5 NM_001014.3  
GCTTTTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAG
HKR071258 ARe78C10 pKA1U5 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR072849 ARe82C01 pKA1U5 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR072876 ARe82D04 pKA1U5 NM_001014.3  
GGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTGC
HKR075732 ARe89F12 pKA1U5 NM_001014.3  
GGGAAGAGACGCAGCACCGCGCATGCTCCTTCTTTTCCAGCCCCGGTACCGGACCCTGCA
HKR077258 ARe93C10 pKA1U5 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR079747 ARe99G03 pKA1U5 NM_001014.3  
GCCTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAA
HKR081610 ARf04A10 pKA1U5 NM_001014.3  
GCTTTTTTTCAGCCCCGGTACCGGACCCTGCACCCTTAGAGATGTTGATGCCTAAGAAGA
HKR082547 ARf06G03 pKA1U5 NM_001014.3  
TGCTTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGA
HKR162452 ARi06C04 pGCAP10 NM_001014.3  
GCTTTTCCNGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR164484 ARi11D12 pGCAP10 NM_001014.3  
TGAGCCCCGGTACCGGACCCTGCAGCCGCAGTAGATGTTGATGCCTAAGAAGAACCGGAT
HKR166973 ARi17H05 pGCAP10 NM_001014.3  
GCTTTTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGANGTTGATGCCTAAGAAG
HKR171300 ARi28E04 pGCAP10 NM_001014.3  
TTTTTTTTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGA
HKR176830 ARi42B06 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR181726 ARi54F06 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCANAGATGTTGATGCCTAAGAAGAAC
HKR184575 ARi61H07 pGCAP10 NM_001014.3  
GCTTTTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAG
HKR205362 ARiS013G18 pGCAP10 NM_001014.3  
GCTTTTCCNGCCCCNNNNCCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR209214 ARiS023A14 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR218018 ARiS045A18 pGCAP10 NM_001014.3  
GCTTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAA
HKR222131 ARiS055F11 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR238472 ARiS096C24 pGCAP10 NM_001014.3  
CCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATT
HKR238609 ARiS096I17 pGCAP10 NM_001014.3  
HKR243661 ARiS109C13 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCNGACCCTGCANCCGCANAGATGTTGATGCCTAACAAGAAC
HKR247224 ARiS118A24 pGCAP10 NM_001014.3  
GCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTGCCA
HKR249097 ARiS122M09 pGCAP10 NM_001014.3  
GCTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAG
HKR264518 ARiS161E22 pGCAP10 NM_001014.3  
TGGGCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAG
HKR321351 RBb03G07 pKA1U5 NM_001014.3  
GCTTTTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAG
HKR324830 RBb12B06 pKA1U5 NM_001014.3  
GAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTG
HKR324955 RBb12G11 pKA1U5 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCANAGATGTTGATGCCTAAGAAGAAC
HKR326523 RBb16F03 pKA1U5 NM_001014.3  
GAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTG
HKR330477 RBb26D05 pGCAP1 NM_001014.3  
GCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTGCC
HKR330504 RBb26E08 pGCAP1 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR332401 RBb31A01 pGCAP1 NM_001014.3  
HKR344025 RBb60B01 pGCAP1 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR348126 RBb70F06 pGCAP1 NM_001014.3  
GCTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAG
HKR360884 RBd02D12 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR361380 RBd03H12 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR362850 RBd07C02 pGCAP10 NM_001014.3  
TGCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAA
HKR364497 RBd11E01 pGCAP10 NM_001014.3  
GCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTGCCAT
HKR364946 RBd12G02 pGCAP10 NM_001014.3  
GCCTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAA
HKR365299 RBd13E03 pGCAP10 NM_001014.3  
GCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTGCCA
HKR366947 RBd17G03 pGCAP10 NM_001014.3  
TCCTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAA
HKR370504 RBd26E08 pGCAP10 NM_001014.3  
GGCATGCTCCTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGC
HKR372947 RBd32G03 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR373676 RBd34D04 pGCAP10 NM_001014.3  
GAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTG
HKR377205 RBd43A05 pGCAP10 NM_001014.3  
GTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACC
HKR377683 RBd44D11 pGCAP10 NM_001014.3  
GATGCTCCTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCT
HKR382808 RBd57A08 pGCAP10 NM_001014.3  
HKR383749 RBd59G05 pGCAP10 NM_001014.3  
GGCTTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGA
HKR386452 RBd66C04 pGCAP10 NM_001014.3  
GCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTGCC
HKR386478 RBd66D06 pGCAP10 NM_001014.3  
GCTTTTCCNGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR388525 RBd71F05 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR389352 RBd73G08 pGCAP10 NM_001014.3  
GCTTTTCCNGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR389625 RBd74B01 pGCAP10 NM_001014.3  
GTCCTTTTTTNANNGCCCNGGNACNAGACCCTGCANNCGTNNCNATGNNNANGNNTANGA
HKR390804 RBd77A04 pGCAP10 NM_001014.3  
CTTTTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGA
HKR391651 RBd79C03 pGCAP10 NM_001014.3  
GCTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAG
HKR392802 RBd82A02 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR393253 RBd83C05 pGCAP10 NM_001014.3  
TGGCATGCTCCTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATG
HKR394081 RBd85D09 pGCAP10 NM_001014.3  
GCTTTTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAG
HKR395707 RBd89E11 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR396030 RBd90B06 pGCAP10 NM_001014.3  
TGCTTTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAG
HKR396899 RBd92E03 pGCAP10 NM_001014.3  
GGCATGCTCCTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGC
HKR397211 RBd93A11 pGCAP10 NM_001014.3  
GCTTTTCCAGCCGCGGTCCCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAACAAAAAC
HKR398430 RBd96B06 pGCAP10 NM_001014.3  
GCTTTTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAG
HKR402826 RBdS007B02 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR402913 RBdS007E17 pGCAP10 NM_001014.3  
GAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTG
HKR403065 RBdS007L01 pGCAP10 NM_001014.3  
TGAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATT
HKR406002 RBdS015A02 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR406180 RBdS015H12 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR428341 RBdS070O05 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR430301 RBdS075M13 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR432480 RBdS081D08 pGCAP10 NM_001014.3  
GCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTGCCA
HKR433454 RBdS083K14 pGCAP10 NM_001014.3  
GAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGATTG
HKR441699 RBdS104E03 pGCAP10 NM_001014.3  
GAGCCGCAGAGGTGAGTTTCTGTGGCGTTCGAGTTCCATCGGCTCCCATCCGGGCTATCC
HKR441943 RBdS104O07 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR442149 RBdS105G05 pGCAP10 NM_001014.3  
GCTTTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGA
HKR444007 RBdS110A07 pGCAP10 NM_001014.3  
GGCATGCTCCTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGC
HKR452831 RBdS132B07 pGCAP10 NM_001014.3  
TGGCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGA
HKR452868 RBdS132C20 pGCAP10 NM_001014.3  
TGGAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAACCGGAT
HKR462547 RBdS156G03 pGCAP10 NM_001014.3  
GGGAAGAGACGCAGCACCGCGCATGCTCCTTCTTTTCCAGCCCCGGTACCGGACCCTGCA
HKR462549 RBdS156G05 pGCAP10 NM_001014.3  
GAGTCCGGAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAGATGCTGTCC
HKR471001 RBdS177I09 pGCAP10 NM_001014.3  
GCTTTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGA
HKR471027 RBdS177J11 pGCAP10 NM_001014.3  
GGCGCATGCTCCTTCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGAT
HKR475024 RBdS187J08 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC
HKR475048 RBdS187K08 pGCAP10 NM_001014.3  
GCTTTTCCAGCCCCGGTACCGGACCCTGCAGCCGCAGAGATGTTGATGCCTAAGAAGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl