Prev. |  KEGG KO K02987 > 

RIKEN DNA Bank Human Resource - RPS4Y1

Gene ID NCBI Gene 6192 |  KEGG hsa:6192
Gene Symbol RPS4Y1
Protein Name ribosomal protein S4, Y-linked 1
Synonyms RPS4Y|S4
Ortholog resources KEGG ortholog (KEGG orthology K02987) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001533 IRAK003N21 pCMV-SPORT6 BC010286 NM_001008 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068576 ARe71H08 pKA1U5 NM_001008.3  
GCTCTTCCGTCGCAGAGTTTCGCCATGGCCCGNGGNCCCAAGAAGCACTTAAAGCGTGTT
HKR077655 ARe94C07 pKA1U5 NM_001008.3  
GCTCTTCCGTCGCAGAGTTTCGCCATGGCCCGGGGCCCCAAGAAGCACTTAAAGCGTGTT
HKR161259 ARi03C11 pGCAP10 NM_001008.3  
GCTCTTCCGTCGCAGAGTTTCGCCATGGCCCGGGGCCCCAAGAAGCACTTAAAGCGTGTT
HKR165746 ARi14G02 pGCAP10 NM_001008.3  
GCTCTTCCGTCGCAGAGTTTCGCCATGGCCCGGGGCCCCAAGAAGCACTTAAAGCGTGTT
HKR170574 ARi26H06 pGCAP10 NM_001008.3  
GCTTCCGTCGCAGAGTTTCGCCATGGCCCGGGGCCCCAAGAAGCACTTAAAGCGTGTTGC
HKR234984 ARiS087H16 pGCAP10 NM_001008.3  
GCTCTTCCGTCGCAGAGTTTCGCCATGGCCCGGGGCCCCAAGAAGCACTTAAAGCGTGTT
HKR276704 ARiS191M16 pGCAP10 NM_001008.3  
GCTCTTCCGTCGCAGAGTTTCGCCATGGCCCGGGGCCCCAAGAAGCACTTAAAGCGTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl