Prev. |  KEGG KO K02987 > 

RIKEN DNA Bank Human Resource - RPS4X

Gene ID NCBI Gene 6191 |  KEGG hsa:6191
Gene Symbol RPS4X
Protein Name ribosomal protein S4 X-linked
Synonyms CCG2|DXS306|RPS4|S4|SCAR|SCR10
Ortholog resources KEGG ortholog (KEGG orthology K02987) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX066743 IRAK166O07 pCMV-SPORT6 BC071662 NM_001007 Full
HGY080715 IRAL001N03 pOTB7 BC000472 NM_001007 Full
HGY089151 IRAL022O15 pOTB7 BC007308 NM_001007 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040479 ARe01D07 pKA1U5 NM_001007.4  
CTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTGG
HKR057275 ARe43D03 pKA1U5 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR058812 ARe47A12 pKA1U5 NM_001007.4  
ATCCTGCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGC
HKR058858 ARe47C10 pKA1U5 NM_001007.4  
TACGCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGG
HKR059211 ARe48A11 pKA1U5 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR062873 ARe57D01 pKA1U5 NM_001007.4  
GAGAGAATTTCCGTCTGATCTATGACACCAAGGNTCGCATTTGCTGTACATCGATATTAC
HKR069255 ARe73C07 pKA1U5 NM_001007.4  
CTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGNTCNCAAGAAGCATCTGAAGCGGGTGG
HKR070435 ARe76B11 pKA1U5 NM_001007.4  
TGCTCTTTCCTTGCCTAACGCAGCCATGGCTCGCTGNTTCCCAAGAAGCATCTGAAGCGG
HKR071302 ARe78E06 pKA1U5 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR076083 ARe90D11 pKA1U5 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR077257 ARe93C09 pKA1U5 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR079723 ARe99F03 pKA1U5 NM_001007.4  
NNNCNTTCCTNCCTACGCAGCCATGGNCTCGTGGTCCCAAGAAGCATCCTGAAGCGGGTG
HKR161369 ARi03H01 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR162522 ARi06F02 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR164522 ARi11F02 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR184827 ARi62B03 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR205325 ARiS013F05 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR205434 ARiS013J18 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR208025 ARiS020B01 pGCAP10 NM_001007.4  
GGGAGTTGANNGGCCAGCTGACCCCTGGCTCTNNNCTANNCANNNTGNACATNGCCNNNN
HKR208106 ARiS020E10 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR218045 ARiS045B21 pGCAP10 NM_001007.4  
CTCTTTCCTTGCCTAACNCANCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTGG
HKR218061 ARiS045C13 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCATCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR222366 ARiS055P06 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR234089 ARiS085D17 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCANCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR234335 ARiS085N23 pGCAP10 NM_001007.4  
CTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTGG
HKR276542 ARiS191F22 pGCAP10 NM_001007.4  
GAATTTCTACGCGCACCGGAAGACGGAGGTCCTCTTTCCTTGCCTAACGCAGCCATGGCT
HKR320879 RBb02D07 pKA1U5 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR322401 RBb06A01 pKA1U5 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR322500 RBb06E04 pKA1U5 NM_001007.4  
GCCTCTTTCCTTGCCTAACGCAGCCATGGCTCGCTGGTTCCCAAGAAGCATCTGAAGCGG
HKR323771 RBb09H03 pKA1U5 NM_001007.4  
TCTCTTTCCTTGCCTAACGCAGCCATGGCTCGCGGTTNCCAAGAAGCATCTGAAGCGGGT
HKR334406 RBb36A06 pGCAP1 NM_001007.4  
GCTCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGG
HKR334949 RBb37G05 pGCAP1 NM_001007.4  
CTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTGG
HKR343606 RBb59A06 pGCAP1 NM_001007.4  
GGAAGACGGAGGTCCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCA
HKR343708 RBb59E12 pGCAP1 NM_001007.4  
AAATGTGCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAG
HKR348570 RBb71H02 pGCAP1 NM_001007.4  
AAATGTGTCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAA
HKR360882 RBd02D10 pGCAP10 NM_001007.4  
GGGAAGACGGAGGTCCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGC
HKR361235 RBd03B11 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR361321 RBd03F01 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR362435 RBd06B11 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR364900 RBd12E04 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR368121 RBd20F01 pGCAP10 NM_001007.4  
CTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTGG
HKR372050 RBd30C02 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR376077 RBd40D05 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR377206 RBd43A06 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR379256 RBd48C08 pGCAP10 NM_001007.4  
GGAAAAATCCGGCGCGCGCAGTCTCCAGCCCCAATTTCTACGCGCACCGGAAGACGGAGG
HKR382580 RBd56H12 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR383277 RBd58D05 pGCAP10 NM_001007.4  
GCTCTTTNCTTGCCTANCGCNCCNTGGCTCGTGGTCCCAAGCNNCNNCTGAAGNGNGTGG
HKR384545 RBd61G01 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR384970 RBd62H02 pGCAP10 NM_001007.4  
TGCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGT
HKR385304 RBd63E08 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR388407 RBd71A07 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR391632 RBd79B08 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR395731 RBd89F11 pGCAP10 NM_001007.4  
GGTCTTTCCTTGCCTAACGCACCCATGACCTCGTGGACCCAGGAAGCATCTGAAGCGGGT
HKR395753 RBd89G09 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR396898 RBd92E02 pGCAP10 NM_001007.4  
TGAGCTGAAAATCCGGCGCGCGCAGTCTCCAGCCCCAATTTCTACGCGCACCGGAAGACG
HKR397274 RBd93D02 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR398075 RBd95D03 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR405573 RBdS013P13 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR406356 RBdS015O20 pGCAP10 NM_001007.4  
GGCGCCAGCAAAGGGCTGAGCTGGGCGGAGCAGCTGAAAATCCGGCGCGCGCAGTCTCCA
HKR428287 RBdS070L23 pGCAP10 NM_001007.4  
CCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR441914 RBdS104N02 pGCAP10 NM_001007.4  
CGNNCGGCCGATGCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCAT
HKR461926 RBdS154N14 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG
HKR462406 RBdS156A06 pGCAP10 NM_001007.4  
GCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTGGC
HKR462640 RBdS156J24 pGCAP10 NM_001007.4  
GCTCTTTCCTTGCCTAACGCAGCCATGGCTCGTGGTCCCAAGAAGCATCTGAAGCGGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl