Prev. |  KEGG KO K02981 > 

RIKEN DNA Bank Human Resource - RPS2

Gene ID NCBI Gene 6187 |  KEGG hsa:6187
Gene Symbol RPS2
Protein Name ribosomal protein S2
Synonyms LLREP3|S2
Ortholog resources KEGG ortholog (KEGG orthology K02981) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006122 IRAK015F02 pCMV-SPORT6 BC016178 NM_002952 Full
HGX008824 IRAK022A24 pCMV-SPORT6 BC016951 NM_002952 Full
HGX019715 IRAK049E19 pCMV-SPORT6 BC025677 NM_002952 Full
HGX066543 IRAK166F23 pCMV-SPORT6 BC071673 NM_002952 Full/var
HGY067289 IRAK168D17 pBluescriptR BC066321 NM_002952 Full
HGX069764 IRAK174G20 pCMV-SPORT6 BC073966 NM_002952 Full
HGY080910 IRAL002E14 pOTB7 BC006559 NM_002952 Full
HGY082665 IRAL006L01 pOTB7 BC001795 NM_002952 Full
HGY085982 IRAL014P22 pOTB7 BC004520 NM_002952 Partial
HGY089460 IRAL023K20 pOTB7 BC021545 NM_002952 Full
HGY090469 IRAL026C21 pOTB7 BC023541 NM_002952 Full
HGY090567 IRAL026G23 pOTB7 BC008862 NM_002952 Full
HGY091075 IRAL027L11 pOTB7 BC010165 NM_002952 Full
HGY091428 IRAL028J12 pOTB7 BC018993 NM_002952 Full
HGY091788 IRAL029H20 pOTB7 BC012354 NM_002952 Full
HGY095912 IRAL039M24 pOTB7 BC032129 NM_002952 Full/var
HGY098883 IRAL047D11 pOTB7 BC052235 NM_002952 Full/var
HGY103325 IRAL058F05 pOTB7 BC075830 NM_002952 Full
HGY103348 IRAL058G04 pOTB7 BC071922 NM_002952 Full
HGY103359 IRAL058G15 pOTB7 BC071923 NM_002952 Full
HGY103568 IRAL058P08 pOTB7 BC071924 NM_002952 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE099647 M01C049B23 pDONR221 MGC14-C12 BC006559 NM_002952  
HGE099695 M01C049D23 pDONR221 MGC14-C12 BC006559 NM_002952  
HGE099743 M01C049F23 pDONR221 MGC14-C12 BC006559 NM_002952  
HGE099791 M01C049H23 pDONR221 MGC14-C12 BC006559 NM_002952  
HGE099839 M01C049J23 pDONR221 MGC14-C12 BC006559 NM_002952  
HGE099887 M01C049L23 pDONR221 MGC14-C12 BC006559 NM_002952  
HGE099935 M01C049N23 pDONR221 MGC14-C12 BC006559 NM_002952  
HGE099983 M01C049P23 pDONR221 MGC14-C12 BC006559 NM_002952  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040929 ARe02F09 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR042001 ARe05A01 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGCTGCAGCGGGGGGGCCCGG
HKR042173 ARe05H05 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR046457 ARe16C09 pKA1U5 NM_002952.3  
GGCTCTTCTTTTCCGACAAAACACCAAATGGCGGATNACGCCGGTGCAGCGGGGGGGCCC
HKR046852 ARe17C04 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR048976 ARe22H08 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATNACTCCGGTGCAGCGGGGGGGCCCGGG
HKR050034 ARe25B10 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR051608 ARe29A08 pKA1U5 NM_002952.3  
GCTTCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCC
HKR051612 ARe29A12 pKA1U5 NM_002952.3  
AGCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGG
HKR058856 ARe47C08 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACTCCGGTGCAGCGGGGGGGCCCGGG
HKR058973 ARe47H05 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACTCCGGTGCAGCGGGGGGGCCCGGG
HKR060077 ARe50D05 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR060152 ARe50G08 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR064552 ARe61G08 pKA1U5 NM_002952.3  
ATCCTGGCTTCTTTTCCGACAAAACACCAAATGCCCGNTATGACGCCGGTGCAGCGGGGG
HKR065703 ARe64E07 pKA1U5 NM_002952.3  
TGGTGCTTCTTTTCCGACAAAACACCAAATGGCGNATGACGCCGGGTGCAGCGGGGGGGC
HKR067205 ARe68A05 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR067627 ARe69B03 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR068809 ARe72A09 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR072505 ARe81E09 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACNCCGGTGCAGCGGGGGGGCCCGGA
HKR074006 ARe85A06 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR074499 ARe86E03 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR074928 ARe87F08 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR075726 ARe89F06 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR076574 ARe91H06 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR077601 ARe94A01 pKA1U5 NM_002952.3  
TGCTTCTTTTCCGACAAAANACCAAATGTGCGTGATGACNCCCGNGCNGCGGGGGGNCCC
HKR079658 ARe99C10 pKA1U5 NM_002952.3  
TGCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGG
HKR082403 ARf06A03 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR161302 ARi03E06 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR161370 ARi03H02 pGCAP10 NM_002952.3  
GCTCTTCCCTTGGGTANCCCCGGATGCGCTCGGGGAACCTGAAACAATCCGATGCCTACG
HKR161634 ARi04B10 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR162435 ARi06B11 pGCAP10 NM_002952.3  
HKR163204 ARi08A04 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR163225 ARi08B01 pGCAP10 NM_002952.3  
GCTTCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCC
HKR164436 ARi11B12 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR165251 ARi13C03 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR167280 ARi18D08 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR167606 ARi19A06 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR168107 ARi20E11 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGNCNCTGCGGGGGGGCCCGG
HKR168500 ARi21E04 pGCAP10 NM_002952.3  
GGTTCCGACAAAACACGTGAGTCCTGTTGGTCGCTGCAGCGGGCCTCTGCGTGGGCGGCG
HKR168925 ARi22F05 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR168980 ARi22H12 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR169748 ARi24G04 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR174058 ARi35C10 pGCAP10 NM_002952.3  
GCTTCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCC
HKR175298 ARi38E02 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR175724 ARi39F04 pGCAP10 NM_002952.3  
TGGCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCG
HKR180575 ARi51H07 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR181274 ARi53D02 pGCAP10 NM_002952.3  
TGCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGG
HKR182028 ARi55B04 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR182825 ARi57B01 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR183346 ARi58G02 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR184436 ARi61B12 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR184454 ARi61C06 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR186570 ARi66H02 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR186851 ARi67C03 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACACCGGTGCAGCGGGGGGGCCCGGG
HKR203330 ARiS008F10 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR205287 ARiS013D15 pGCAP10 NM_002952.3  
GCTTCNTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR205488 ARiS013L24 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR208171 ARiS020H03 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR209422 ARiS023J06 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR209549 ARiS023O13 pGCAP10 NM_002952.3  
GCTTCTTTNNNNACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR222345 ARiS055O09 pGCAP10 NM_002952.3  
TGCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGG
HKR234375 ARiS085P15 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR235165 ARiS087P05 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR238671 ARiS096L07 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR243830 ARiS109J14 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR247251 ARiS118C03 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR264535 ARiS161F15 pGCAP10 NM_002952.3  
GCTTCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCC
HKR276606 ARiS191I14 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR277667 ARiS194C19 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGA
HKR324149 RBb10G05 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACTCCGGATGCAGCGGGGGGGCCCGG
HKR327674 RBb19D02 pKA1U5 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGATGCAGCGGGGGGGCCCGG
HKR332903 RBb32E07 pGCAP1 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGCTGCAGCGGGGGGGCCCGG
HKR333329 RBb33F09 pGCAP1 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGCTGCAGCGGGGGGGCCCGG
HKR340025 RBb50B01 pGCAP1 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGCTGCAGCGGGGGGGCCCGG
HKR342905 RBb57E09 pGCAP1 NM_002952.3  
CCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR344007 RBb60A07 pGCAP1 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR345301 RBb63E05 pGCAP1 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR347748 RBb69G04 pGCAP1 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR348025 RBb70B01 pGCAP1 NM_002952.3  
GCTTCTTTTCCGACAAAACACGTGAGTCCTGTTGGTCGCTGCAGCGGGCCTCTGCGTGGG
HKR348128 RBb70F08 pGCAP1 NM_002952.3  
GTCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGG
HKR360832 RBd02B08 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR364146 RBd10G02 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR367378 RBd18H10 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR370050 RBd25C02 pGCAP10 NM_002952.3  
AGCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGG
HKR370503 RBd26E07 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR372835 RBd32B11 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR373380 RBd33H12 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR374097 RBd35E01 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR377281 RBd43D09 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACGTGAGTCCTGTTGGTCGCTGCAGCGGGCCTCTGCGTGGG
HKR379324 RBd48F04 pGCAP10 NM_002952.3  
AAGCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCG
HKR379705 RBd49E09 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR383204 RBd58A04 pGCAP10 NM_002952.3  
GTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCNNNNNNNNGGGCCCGGGG
HKR383249 RBd58C01 pGCAP10 NM_002952.3  
GTCTTTNCCNANNNCCNNGNNTGGNNAGANGACNNCNGGGCCNNNNGGGGGCCCGGGGGC
HKR384081 RBd60D09 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR384833 RBd62B09 pGCAP10 NM_002952.3  
TGCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGG
HKR388480 RBd71D08 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR389608 RBd74A08 pGCAP10 NM_002952.3  
TAGCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCG
HKR390501 RBd76E05 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR391252 RBd78C04 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR392010 RBd80A10 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACGTGAGTCCTGTTGGTCGCTGCAGCGGGCCTCTGCGTGGG
HKR392033 RBd80B09 pGCAP10 NM_002952.3  
TGCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGG
HKR392578 RBd81H10 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR394148 RBd85G04 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR394953 RBd87G09 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR395232 RBd88B08 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR398127 RBd95F07 pGCAP10 NM_002952.3  
GCTTCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCC
HKR403060 RBdS007K20 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR405327 RBdS013F07 pGCAP10 NM_002952.3  
TGGCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCG
HKR408837 RBdS022B13 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACNAANCACCAAATGGCGGATGACNCCNGTGCNNCGGGGGGGCCCGGG
HKR420692 RBdS051M04 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR428046 RBdS070B22 pGCAP10 NM_002952.3  
TGCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGG
HKR428253 RBdS070K13 pGCAP10 NM_002952.3  
TAGCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCG
HKR430214 RBdS075I22 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR432492 RBdS081D20 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR432692 RBdS081M04 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR441616 RBdS104A16 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR441819 RBdS104J03 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR444178 RBdS110H10 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACGTGAGTCCTGTTGGTCGCTGCAGCGGGCCTCTGCGTGGG
HKR462420 RBdS156A20 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR470892 RBdS177D20 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR471002 RBdS177I10 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG
HKR475069 RBdS187L05 pGCAP10 NM_002952.3  
GCTTCTTTTCCGACAAAACACCAAATGGCGGATGACGCCGGTGCAGCGGGGGGGCCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl