Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MRPS12

Gene ID (NCBI) 6183
Gene Symbol MRPS12
Protein Name mitochondrial ribosomal protein S12
Synonyms MPR-S12|MT-RPS12|RPMS12|RPS12|RPSM12
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02950)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083536 IRAL008N24 pOTB7 BC001617 NM_033363 Full
HGY084005 IRAL010A05 pOTB7 BC007499 NM_033363 Full
HGY087376 IRAL018H08 pOTB7 BC006424 NM_033363 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR123627 ARh09B03 pGCAP1 NM_021107.1  
GGGATTCAGCGTGTCCGCGACCTCACCTTTAGGTCCTGTGAGGGACGGCCCAGG
HKR369302 RBd23E06 pGCAP10 NM_021107.1  
GGGATTCAGCGTGTCCGCGACCTCACCTTTAGGTCCTGTGAGGGACGGCCCAGGTGGCAG
HKR441832 RBdS104J16 pGCAP10 NM_021107.1  
GAGGTCCTGTGAGGTCGGTGGAATCCTGGGGTCCTCCAAATCTACCAGGCCATCTCCCCA
HKR461933 RBdS154N21 pGCAP10 NM_021107.1  
GAGCGTGTCCGCGACCTCACCTTTAGGTCCTGTGAGGGACGGCCCAGGTGGCAGGATGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl