Prev. |  KEGG KO K02935 > 

RIKEN DNA Bank Human Resource - MRPL12

Gene ID NCBI Gene 6182 |  KEGG hsa:6182
Gene Symbol MRPL12
Protein Name mitochondrial ribosomal protein L12
Synonyms 5c5-2|L12mt|MRP-L31/34|MRPL7|MRPL7/L12|RPML12
Ortholog resource in our bank

  MRPL12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080689 IRAL001M01 pOTB7 BC002344 NM_002949 Full
HGY084297 IRAL010M09 pOTB7 BC007497 NM_002949 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098001 M01C045A01 pDONR221 MGC12-A01 BC007497 ENST00000332396  
HGE098049 M01C045C01 pDONR221 MGC12-A01 BC007497 ENST00000332396  
HGE098097 M01C045E01 pDONR221 MGC12-A01 BC007497 ENST00000332396  
HGE098145 M01C045G01 pDONR221 MGC12-A01 BC007497 ENST00000332396  
HGE098193 M01C045I01 pDONR221 MGC12-A01 BC007497 ENST00000332396  
HGE098241 M01C045K01 pDONR221 MGC12-A01 BC007497 ENST00000332396  
HGE098289 M01C045M01 pDONR221 MGC12-A01 BC007497 ENST00000332396  
HGE098337 M01C045O01 pDONR221 MGC12-A01 BC007497 ENST00000332396  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060977 ARe52H09 pKA1U5 NM_002949.2  
ATNCNGGCGCTCGCCTCCTCCCGGGGAACCGCGCCCTTNNATTCCAGCCCGCGGACCGAT
HKR070481 ARe76D09 pKA1U5 NM_002949.2  
GGTCATTTCCGGCTCGAATGCCCGGCAGCCGCTGGCNTGCTAGAGCGTTCCTCCCCAGCT
HKR082097 ARf05E01 pKA1U5 NM_002949.2  
GGTCGCCTCCTCCCGGGGAACCGCGTGTGACCTTCCAGCCCGCGGACCGATGCTGCCGGC
HKR082179 ARf05H11 pKA1U5 NM_002949.2  
GAGCGTCGCCTCCTCCCGGGGAACCGCGTGTGACCTTCCAGCCCGCGGACCGATGCTGCC
HKR164546 ARi11G02 pGCAP10 NM_002949.2  
GGTCATTTCCGGCTCGAATGCCCGGCAGCCGTGGCGGCTAGAGCGTTCCTCCCCAGCTCG
HKR186856 ARi67C08 pGCAP10 NM_002949.2  
GGTCATTTCCGGCTCGAATGCCCGGCAGCCGTGGCGGCTAGAGCGTTCCTCCCCAGCTCG
HKR326172 RBb15H04 pKA1U5 NM_002949.2  
GGGGGAACCGCGNTGTGACCTTCCAGCCCGCGGACCTNTGCTGCCGGCGGCCGCTCGCCC
HKR336879 RBb42D07 pGCAP1 NM_002949.2  
TTGTCCCGGGGAACCGCGTGTGACCTTCCAGCCCGCGGACCGATGCTGCCGGCGGCCGCT
HKR341705 RBb54E09 pGCAP1 NM_002949.2  
GGGGGAACCGCGTGTTGACCTTCCAGCCCGCGGTACCGATGCTGCCGGCGGCCGCTCGCC
HKR376011 RBd40A11 pGCAP10 NM_002949.2  
GCCGGCGGCCGAGGCGGCTAGAGCGTCGCCTCCTCCCGGGGAACCGCGTGTGACCTTCCA
HKR393371 RBd83H03 pGCAP10 NM_002949.2  
GCGGCGGCCGAGGCGGCTAGAGCGTCGCCTCCTCCCGGGGAACCGCGTGTGACCTTCCAG
HKR396979 RBd92H11 pGCAP10 NM_002949.2  
GGGGGAACCGCGTGTGACCTTCCAGCCCGCGGACCGATGCTGCCGGCGGCCGCTCGCCCC
HKR444054 RBdS110C06 pGCAP10 NM_002949.2  
GCCGGCGGCCGAGGCGGCTAGAGCGTCGCCTCCTCCCGGGGAACCGCGTGTGACCTTCCA
HKR444172 RBdS110H04 pGCAP10 NM_002949.2  
GGTCGCCTCCTCCCGGGGAACCGCGTGTGACCTTCCAGCCCGCGGACCGATGCTGCCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl