Prev. |  KEGG KO K02929 > 

RIKEN DNA Bank Human Resource - RPL36A

Gene ID NCBI Gene 6173 |  KEGG hsa:6173
Gene Symbol RPL36A
Protein Name ribosomal protein L36a
Synonyms L36A|L44L|MIG6|RPL44
Ortholog resources KEGG ortholog (KEGG orthology K02929) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082715 IRAL006N03 pOTB7 BC001781 NM_021029 Full
HGY096579 IRAL041H11 pDNR-LIB BC031015 NM_021029 Full
HGY100779 IRAL051P19 pDNR-LIB BC062219 NM_021029 Full
HGY102967 IRAL057G23 pDNR-LIB BC070204 NM_021029 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097221 M01C043A21 pDONR221 MGC11-A11 BC001781 NM_021029  
HGE097269 M01C043C21 pDONR221 MGC11-A11 BC001781 NM_021029  
HGE097317 M01C043E21 pDONR221 MGC11-A11 BC001781 NM_021029  
HGE097365 M01C043G21 pDONR221 MGC11-A11 BC001781 NM_021029  
HGE097413 M01C043I21 pDONR221 MGC11-A11 BC001781 NM_021029  
HGE097461 M01C043K21 pDONR221 MGC11-A11 BC001781 NM_021029  
HGE097509 M01C043M21 pDONR221 MGC11-A11 BC001781 NM_021029  
HGE097557 M01C043O21 pDONR221 MGC11-A11 BC001781 NM_021029  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040955 ARe02G11 pKA1U5 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR043209 ARe08A09 pKA1U5 NM_021029.4  
GCTTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGAC
HKR049298 ARe23E02 pKA1U5 NM_021029.4  
TTGCTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCC
HKR049650 ARe24C02 pKA1U5 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR054124 ARe35F04 pKA1U5 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGCTTAACGTCCCTAAAACCCGCCGGAC
HKR060026 ARe50B02 pKA1U5 NM_021029.4  
GTCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCC
HKR062175 ARe55H07 pKA1U5 NM_021029.4  
GCTTCTTTCCGCGCCGATGCGCTCACGCAAGCCTGNTTAACGTCCCTAAAACCCGCCGGA
HKR071300 ARe78E04 pKA1U5 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTTAACGTCCCTAAAACCCGCC
HKR072549 ARe81G05 pKA1U5 NM_021029.4  
GTCTTCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCC
HKR072804 ARe82A04 pKA1U5 NM_021029.4  
TGCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCC
HKR078575 ARe96H07 pKA1U5 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGCTTAACGTCCCTAAAACCCGCCGGAC
HKR163659 ARi09C11 pGCAP10 NM_021029.4  
GCTTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCC
HKR164498 ARi11E02 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR176401 ARi41A01 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR179728 ARi49F08 pGCAP10 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR188484 ARi71D12 pGCAP10 NM_021029.4  
GCTTTTTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR203232 ARiS008B08 pGCAP10 NM_021029.4  
GCTTTTTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR203502 ARiS008M14 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR205265 ARiS013C17 pGCAP10 NM_021029.4  
GNTTTCCNNNCCNNTNNNGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR205380 ARiS013H12 pGCAP10 NM_021029.4  
GCTATATACTTCCGTTTGCCTCGCGGTTTCTTTCTTTCCGCGCCGATAGCGCTCACGCAA
HKR208166 ARiS020G22 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR219851 ARiS049K11 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR222162 ARiS055G18 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR234320 ARiS085N08 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR247227 ARiS118B03 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR260379 ARiS150P19 pGCAP10 NM_021029.4  
CCTTTTTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR264492 ARiS161D20 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR276604 ARiS191I12 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR279324 ARiS198F04 pGCAP10 NM_021029.4  
HKR279546 ARiS198O10 pGCAP10 NM_021029.4  
AGCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGAC
HKR321371 RBb03H03 pKA1U5 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR324132 RBb10F12 pKA1U5 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR324529 RBb11F09 pKA1U5 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGCTTAACGTCCCTAAAACCCGCCGGAC
HKR326010 RBb15A10 pKA1U5 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR327227 RBb18B03 pKA1U5 NM_021029.4  
ATCCTGGCTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACC
HKR330836 RBb27B12 pGCAP1 NM_021029.4  
TCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACTTTCT
HKR333726 RBb34F06 pGCAP1 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTTCCCTAAAACCCGCCGGAC
HKR336546 RBb41G02 pGCAP1 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTTCCCTAAAACCCGCCGGAC
HKR337205 RBb43A05 pGCAP1 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR339659 RBb49C11 pGCAP1 NM_021029.4  
AGCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGCTCCCTAAAACCCGCCGGA
HKR344051 RBb60C03 pGCAP1 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR344574 RBb61H06 pGCAP1 NM_021029.4  
GCTTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCC
HKR347233 RBb68B09 pGCAP1 NM_021029.4  
AAATGTGCTTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAA
HKR366006 RBd15A06 pGCAP10 NM_021029.4  
CGGCCGGCCGATGCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAA
HKR366908 RBd17E12 pGCAP10 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR368506 RBd21E10 pGCAP10 NM_021029.4  
GCTATGATTGCTCCTACCGACTCCCATGAGGAAGTGCGATCGGGAACCTCCTATATACTT
HKR368835 RBd22B11 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR371227 RBd28B03 pGCAP10 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR372954 RBd32G10 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR373374 RBd33H06 pGCAP10 NM_021029.4  
TGAGAGCGCAGCGCGCACGCCCAGCGAGTTCCAGAGGCGCCAGTGGAAGCTGCGGCGGCG
HKR373649 RBd34C01 pGCAP10 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR376828 RBd42B04 pGCAP10 NM_021029.4  
GCTTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCC
HKR377330 RBd43F10 pGCAP10 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR379655 RBd49C07 pGCAP10 NM_021029.4  
GATATTCTTCCGTNTGCCTCGCGGTTTCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGC
HKR379779 RBd49H11 pGCAP10 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR380955 RBd52G11 pGCAP10 NM_021029.4  
GACCTCCTCTCCTTCCTCNCCGATTGANCTCCCANCGNCAGGAGTGANGTNCCTAAAACC
HKR380979 RBd52H11 pGCAP10 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR386003 RBd65A03 pGCAP10 NM_021029.4  
GCTTTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGC
HKR386833 RBd67B09 pGCAP10 NM_021029.4  
TGCTTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGA
HKR386932 RBd67F12 pGCAP10 NM_021029.4  
GTCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCC
HKR388860 RBd72C12 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR388974 RBd72H06 pGCAP10 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR389652 RBd74C04 pGCAP10 NM_021029.4  
GTCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCC
HKR390428 RBd76B04 pGCAP10 NM_021029.4  
GTTTCNTTNNNCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGG
HKR393660 RBd84C12 pGCAP10 NM_021029.4  
GTTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR396008 RBd90A08 pGCAP10 NM_021029.4  
CGGCCGGCCGATGCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCC
HKR398427 RBd96B03 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR399701 RBd99E05 pGCAP10 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR402898 RBdS007E02 pGCAP10 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR405435 RBdS013J19 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR405451 RBdS013K11 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR406161 RBdS015G17 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR406174 RBdS015H06 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR409177 RBdS022P17 pGCAP10 NM_021029.4  
GCTTTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGC
HKR420447 RBdS051B23 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR430077 RBdS075D05 pGCAP10 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR441797 RBdS104I05 pGCAP10 NM_021029.4  
GCTTTTTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCC
HKR442018 RBdS105A18 pGCAP10 NM_021029.4  
GCTTTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGC
HKR452981 RBdS132H13 pGCAP10 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAANNCCCGCCG
HKR453160 RBdS132O24 pGCAP10 NM_021029.4  
GCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR462504 RBdS156E08 pGCAP10 NM_021029.4  
GCTTTTTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCG
HKR462594 RBdS156I02 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
HKR470825 RBdS177B01 pGCAP10 NM_021029.4  
GCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl