Prev. |  KEGG KO K02912 > 

RIKEN DNA Bank Human Resource - RPL32

Gene ID NCBI Gene 6161 |  KEGG hsa:6161
Gene Symbol RPL32
Protein Name ribosomal protein L32
Synonyms L32|PP9932
Ortholog resources KEGG ortholog (KEGG orthology K02912) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001491 IRAK003M03 pCMV-SPORT6 BC011514 NM_001007074 Full
HGY103127 IRAL057N15 pDNR-LIB BC070209 NM_001007074 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE091605 M01C029A05 pDONR221 MGC04-A03 BC011514 XM_939244  
HGE091653 M01C029C05 pDONR221 MGC04-A03 BC011514 XM_939244  
HGE091701 M01C029E05 pDONR221 MGC04-A03 BC011514 XM_939244  
HGE091749 M01C029G05 pDONR221 MGC04-A03 BC011514 XM_939244  
HGE091797 M01C029I05 pDONR221 MGC04-A03 BC011514 XM_939244  
HGE091845 M01C029K05 pDONR221 MGC04-A03 BC011514 XM_939244  
HGE091893 M01C029M05 pDONR221 MGC04-A03 BC011514 XM_939244  
HGE091941 M01C029O05 pDONR221 MGC04-A03 BC011514 XM_939244  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040530 ARe01F10 pKA1U5 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGC
HKR040972 ARe02H04 pKA1U5 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR042004 ARe05A04 pKA1U5 NM_000994.3  
GCCCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCA
HKR042178 ARe05H10 pKA1U5 NM_000994.3  
GCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCC
HKR048028 ARe20B04 pKA1U5 NM_000994.3  
GCTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGG
HKR048857 ARe22C09 pKA1U5 NM_000994.3  
GGCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGC
HKR049235 ARe23B11 pKA1U5 NM_000994.3  
TCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCCTCA
HKR049634 ARe24B10 pKA1U5 NM_000994.3  
GCCCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCA
HKR050075 ARe25D03 pKA1U5 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR050975 ARe27H07 pKA1U5 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR053255 ARe33C07 pKA1U5 NM_000994.3  
GCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCC
HKR054945 ARe37G01 pKA1U5 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR054971 ARe37H03 pKA1U5 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR055632 ARe39B08 pKA1U5 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACNGAGGTGGCAGCCATCATCCTTCTCGGCATCATGGCCG
HKR058052 ARe45C04 pKA1U5 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCCGCNATCTCCTTCTCGGCATCATGGCC
HKR058950 ARe47G06 pKA1U5 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR065204 ARe63A04 pKA1U5 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR065321 ARe63F01 pKA1U5 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCNTCTCCTTCTCGGCATCATGGCCGC
HKR066409 ARe66A09 pKA1U5 NM_000994.3  
GCTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGG
HKR068132 ARe70F12 pKA1U5 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGC
HKR068929 ARe72F09 pKA1U5 NM_000994.3  
GCCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCAT
HKR069236 ARe73B12 pKA1U5 NM_000994.3  
TGCTCTCTTCCTCGGCGCTGCCTACGGAGGTGNCAGCCATCTCCTTCTCGGCATCATGGC
HKR069611 ARe74A11 pKA1U5 NM_000994.3  
GCCCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCA
HKR070073 ARe75D01 pKA1U5 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGC
HKR070554 ARe76G10 pKA1U5 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCACCCATCTCCTTCTCGGCATCATGGCCGC
HKR070578 ARe76H10 pKA1U5 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCACCCNTCTCCTTCTCGGCATCATGGCCGC
HKR070827 ARe77B03 pKA1U5 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGC
HKR082811 ARf07A11 pKA1U5 NM_000994.3  
GCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCC
HKR164876 ARi12D04 pGCAP10 NM_000994.3  
GCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCC
HKR165377 ARi13H09 pGCAP10 NM_000994.3  
GCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATG
HKR168075 ARi20D03 pGCAP10 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR170407 ARi26A07 pGCAP10 NM_000994.3  
GCTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGG
HKR171301 ARi28E05 pGCAP10 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR175779 ARi39H11 pGCAP10 NM_000994.3  
GCTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGG
HKR176074 ARi40D02 pGCAP10 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR179371 ARi48H03 pGCAP10 NM_000994.3  
GCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATG
HKR184932 ARi62F12 pGCAP10 NM_000994.3  
TCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCC
HKR186881 ARi67D09 pGCAP10 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR208205 ARiS020I13 pGCAP10 NM_000994.3  
GTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCC
HKR218348 ARiS045O12 pGCAP10 NM_000994.3  
AACTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCG
HKR234997 ARiS087I05 pGCAP10 NM_000994.3  
GAGGTGGCAGCCATCTCCTTCTCGCTGGCGATTGGAAGACACTCTGCGACAGTGTTCAGT
HKR235375 ARiS088H07 pGCAP10 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR238565 ARiS096G21 pGCAP10 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGC
HKR243897 ARiS109M09 pGCAP10 NM_000994.3  
GCTCTTCCTCNGCGCNNCCTACCGAGGTGNCACCCNTCTCNNTGTNGNAATGNTGNCCGA
HKR247209 ARiS118A09 pGCAP10 NM_000994.3  
GAGCCATCTCCTTCTCGGCATCATGGCCGCCCTCAGACCCCTTGTGAAGCCCAAGATCGT
HKR247296 ARiS118D24 pGCAP10 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR260142 ARiS150F22 pGCAP10 NM_000994.3  
GGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCCTCAGACCCCTTGTGAAGCCCAA
HKR264582 ARiS161H14 pGCAP10 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR276569 ARiS191H01 pGCAP10 NM_000994.3  
GGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCCTCAGACCCCTTGTGAAGCCC
HKR276711 ARiS191M23 pGCAP10 NM_000994.3  
GAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCCTCAGACCCCTTGTGAAGCCCA
HKR276777 ARiS191P17 pGCAP10 NM_000994.3  
GCCCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCA
HKR277863 ARiS194K23 pGCAP10 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGC
HKR279323 ARiS198F03 pGCAP10 NM_000994.3  
GCTCTCNNCCTCGGCGCNGCCTACGGAGGNGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR279541 ARiS198O05 pGCAP10 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGC
HKR320899 RBb02E03 pKA1U5 NM_000994.3  
TGCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCG
HKR321325 RBb03F05 pKA1U5 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR322434 RBb06B10 pKA1U5 NM_000994.3  
GCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCC
HKR325307 RBb13E11 pKA1U5 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR325776 RBb14H08 pKA1U5 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCATCCTTCTCGGCATCATGGCCG
HKR326005 RBb15A05 pKA1U5 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR327632 RBb19B08 pKA1U5 NM_000994.3  
GTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCG
HKR327633 RBb19B09 pKA1U5 NM_000994.3  
GTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCG
HKR328101 RBb20E05 pKA1U5 NM_000994.3  
GTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATNTCCTTCTCGGCATCATGGCCGCC
HKR328452 RBb21C04 pKA1U5 NM_000994.3  
CCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATG
HKR330827 RBb27B03 pGCAP1 NM_000994.3  
TGGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCCTCANACCCCTTGTGAAGCCCA
HKR331601 RBb29A01 pGCAP1 NM_000994.3  
GTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCCT
HKR332103 RBb30E07 pGCAP1 NM_000994.3  
GTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGC
HKR336103 RBb40E07 pGCAP1 NM_000994.3  
GTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGC
HKR340172 RBb50H04 pGCAP1 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR340405 RBb51A05 pGCAP1 NM_000994.3  
GCCCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCA
HKR340945 RBb52G01 pGCAP1 NM_000994.3  
GCCCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCA
HKR342505 RBb56E09 pGCAP1 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR342851 RBb57C03 pGCAP1 NM_000994.3  
TGCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGC
HKR345378 RBb63H10 pGCAP1 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR345676 RBb64D04 pGCAP1 NM_000994.3  
GCTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGG
HKR348122 RBb70F02 pGCAP1 NM_000994.3  
GTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCG
HKR361305 RBd03E09 pGCAP10 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR363606 RBd09A06 pGCAP10 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGC
HKR363774 RBd09H06 pGCAP10 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR364877 RBd12D05 pGCAP10 NM_000994.3  
GTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCG
HKR366508 RBd16E12 pGCAP10 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGC
HKR371211 RBd28A11 pGCAP10 NM_000994.3  
CGGCCGGCCGATGATCTCCTTCTCGGCATCATGGCCGCCCTCAGACCCCTTGTGAAGCCC
HKR372854 RBd32C06 pGCAP10 NM_000994.3  
GCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCC
HKR374806 RBd37A06 pGCAP10 NM_000994.3  
GCCCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCA
HKR375252 RBd38C04 pGCAP10 NM_000994.3  
CGGCCGGCCGATGCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTC
HKR381374 RBd53H06 pGCAP10 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR385305 RBd63E09 pGCAP10 NM_000994.3  
GAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCCTCAGACCCCTTGTGAAGCCCA
HKR386074 RBd65D02 pGCAP10 NM_000994.3  
GTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCC
HKR389281 RBd73D09 pGCAP10 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGC
HKR390502 RBd76E06 pGCAP10 NM_000994.3  
GCCCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCA
HKR392131 RBd80F11 pGCAP10 NM_000994.3  
GCTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGG
HKR397228 RBd93B04 pGCAP10 NM_000994.3  
TGCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGC
HKR397328 RBd93F08 pGCAP10 NM_000994.3  
GGGGATTCATCTGGCCCCGTCGCCCAGTGGTGCGGAGGCCTCCCCTTCAGCGCGGTAGTG
HKR397675 RBd94D03 pGCAP10 NM_000994.3  
GCTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGG
HKR405838 RBdS014J22 pGCAP10 NM_000994.3  
GCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCC
HKR406211 RBdS015I19 pGCAP10 NM_000994.3  
GTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGC
HKR408932 RBdS022F12 pGCAP10 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGC
HKR416070 RBdS040C22 pGCAP10 NM_000994.3  
TGCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCG
HKR416181 RBdS040H13 pGCAP10 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGC
HKR433303 RBdS083E07 pGCAP10 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR433455 RBdS083K15 pGCAP10 NM_000994.3  
GCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGC
HKR441633 RBdS104B09 pGCAP10 NM_000994.3  
ACGCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGG
HKR441695 RBdS104D23 pGCAP10 NM_000994.3  
GCCCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCA
HKR442122 RBdS105F02 pGCAP10 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR442131 RBdS105F11 pGCAP10 NM_000994.3  
GTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCG
HKR444302 RBdS110M14 pGCAP10 NM_000994.3  
GGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCCTCAGACCCCTTGTGAAGCCCAAGAT
HKR461721 RBdS154F01 pGCAP10 NM_000994.3  
GCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCC
HKR470872 RBdS177C24 pGCAP10 NM_000994.3  
GCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGCCGCCCTCAG
HKR471151 RBdS177O15 pGCAP10 NM_000994.3  
TGCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCATGGC
HKR474943 RBdS187F23 pGCAP10 NM_000994.3  
GCCCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCATCTCCTTCTCGGCATCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl