Prev. |  KEGG KO K02898 > 

RIKEN DNA Bank Human Resource - RPL26

Gene ID NCBI Gene 6154 |  KEGG hsa:6154
Gene Symbol RPL26
Protein Name ribosomal protein L26
Synonyms DBA11|L26
Ortholog resources KEGG ortholog (KEGG orthology K02898) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX066607 IRAK166I15 pCMV-SPORT6 BC071664 NM_000987 Full
HGY067206 IRAK168A06 pBluescriptR BC066316 NM_000987 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040506 ARe01E10 pKA1U5 NM_000987.3  
AGCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCT
HKR041203 ARe03A03 pKA1U5 NM_000987.3  
GCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTG
HKR043748 ARe09G04 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR044401 ARe11A01 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR044811 ARe12A11 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR052012 ARe30A12 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR056946 ARe42G02 pKA1U5 NM_000987.3  
GCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGA
HKR058129 ARe45F09 pKA1U5 NM_000987.3  
GTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTT
HKR059373 ARe48H05 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGNGCGGCCAAAATGAAGTTTAATCCCTT
HKR060128 ARe50F08 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR064853 ARe62C05 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR066451 ARe66C03 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR069723 ARe74F03 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR070529 ARe76F09 pKA1U5 NM_000987.3  
GCTCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGANCGGCCAAAATGAAGTTTAATCCC
HKR071703 ARe79E07 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR075756 ARe89G12 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR076523 ARe91F03 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR077212 ARe93A12 pKA1U5 NM_000987.3  
GCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGA
HKR078429 ARe96B05 pKA1U5 NM_000987.3  
GCCCTTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTG
HKR081326 ARf03F06 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR082155 ARf05G11 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR082177 ARf05H09 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR162529 ARi06F09 pGCAP10 NM_000987.3  
GCTCTTCCCTTTGGCGGCCATCACCGAAGCGGGAGCGGCCAGATGAAGTTTAATCCCTTT
HKR164951 ARi12G07 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR165631 ARi14B07 pGCAP10 NM_000987.3  
GCTCCTTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCC
HKR167745 ARi19G01 pGCAP10 NM_000987.3  
TTGCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGT
HKR170050 ARi25C02 pGCAP10 NM_000987.3  
GCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGA
HKR170546 ARi26G02 pGCAP10 NM_000987.3  
GCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTG
HKR171250 ARi28C02 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR171302 ARi28E06 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR174570 ARi36H02 pGCAP10 NM_000987.3  
GCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGA
HKR175706 ARi39E10 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR176100 ARi40E04 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR177236 ARi43B12 pGCAP10 NM_000987.3  
TTGCTCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATC
HKR178027 ARi45B03 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR178409 ARi46A09 pGCAP10 NM_000987.3  
CGCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCT
HKR178972 ARi47H04 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR180828 ARi52B04 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR184060 ARi60C12 pGCAP10 NM_000987.3  
CGGCCGGCCGATGCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAA
HKR184978 ARi62H10 pGCAP10 NM_000987.3  
GCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGA
HKR185606 ARi64A06 pGCAP10 NM_000987.3  
CTCNNCNTTTGCGCNTCNCGANNGGAGCGCANTGANNANCNTTGTNACTCNACGAGCAGAT
HKR188449 ARi71C01 pGCAP10 NM_000987.3  
GCCCTTTCCCTGAGCCGCCGCCGAGGATTCAGCAGCCTCCCCCTTGAACCTCCTCCCCTT
HKR188504 ARi71E08 pGCAP10 NM_000987.3  
GCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGA
HKR188522 ARi71F02 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR203468 ARiS008L04 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR205501 ARiS013M13 pGCAP10 NM_000987.3  
GGCGGCCATCACCGAANCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGACTTCCGA
HKR205521 ARiS013N09 pGCAP10 NM_000987.3  
GCCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTG
HKR219806 ARiS049I14 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR222108 ARiS055E12 pGCAP10 NM_000987.3  
TTGCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCC
HKR234046 ARiS085B22 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR238568 ARiS096G24 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR238750 ARiS096O14 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR243869 ARiS109L05 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR248837 ARiS122B13 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR249098 ARiS122M10 pGCAP10 NM_000987.3  
GCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGA
HKR264439 ARiS161B15 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR264537 ARiS161F17 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR264617 ARiS161J01 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR264700 ARiS161M12 pGCAP10 NM_000987.3  
GCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGA
HKR264721 ARiS161N09 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR276592 ARiS191H24 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR279216 ARiS198A16 pGCAP10 NM_000987.3  
NTCCTNNTNGCGGCCATCACCGAAGCGGGAGCGGCCAAAATTGAAGTTTAATCCCTTTTG
HKR321628 RBb04B04 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR322431 RBb06B07 pKA1U5 NM_000987.3  
ATCCTGGTGGCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTT
HKR324974 RBb12H06 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR326170 RBb15H02 pKA1U5 NM_000987.3  
GCTCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCC
HKR327323 RBb18F03 pKA1U5 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR328580 RBb21H12 pKA1U5 NM_000987.3  
GCTCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCC
HKR329678 RBb24D06 pGCAP1 NM_000987.3  
GTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGT
HKR330177 RBb25H09 pGCAP1 NM_000987.3  
TGCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCT
HKR333609 RBb34A09 pGCAP1 NM_000987.3  
AATGTGCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAAT
HKR337255 RBb43C07 pGCAP1 NM_000987.3  
AAATGTGTGGAATCAGCAGCCATCCGTTCTTGGGCATGGTGGCTTCCGACCGCGGGGACC
HKR340059 RBb50C11 pGCAP1 NM_000987.3  
CTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTT
HKR340809 RBb52A09 pGCAP1 NM_000987.3  
GCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTG
HKR342097 RBb55E01 pGCAP1 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCT
HKR344149 RBb60G05 pGCAP1 NM_000987.3  
TGCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCT
HKR347773 RBb69H05 pGCAP1 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR362905 RBd07E09 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR363298 RBd08E02 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR366412 RBd16A12 pGCAP10 NM_000987.3  
TGCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGAC
HKR366527 RBd16F07 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCGCCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR374156 RBd35G12 pGCAP10 NM_000987.3  
TGCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCT
HKR374827 RBd37B03 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR376059 RBd40C11 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR377723 RBd44F03 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR380554 RBd51G10 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR381210 RBd53A10 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR384033 RBd60B09 pGCAP10 NM_000987.3  
GCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGACT
HKR384475 RBd61D03 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR386433 RBd66B09 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR387607 RBd69A07 pGCAP10 NM_000987.3  
GCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGA
HKR389233 RBd73B09 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR389750 RBd74G06 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR392059 RBd80C11 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR392508 RBd81E12 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR394956 RBd87G12 pGCAP10 NM_000987.3  
TGGCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCC
HKR395307 RBd88E11 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR397253 RBd93C05 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR402861 RBdS007C13 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR402986 RBdS007H18 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR405780 RBdS014H12 pGCAP10 NM_000987.3  
GGGGTAAGGATTCGGCGGGCAAGCGGGTGTAATCAGCAGCCATCCGTTCTTGGGCATGGT
HKR406101 RBdS015E05 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR406220 RBdS015J04 pGCAP10 NM_000987.3  
AGCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTG
HKR406238 RBdS015J22 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR409033 RBdS022J17 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR409102 RBdS022M14 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR409147 RBdS022O11 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR416341 RBdS040O05 pGCAP10 NM_000987.3  
TGGCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCC
HKR420589 RBdS051H21 pGCAP10 NM_000987.3  
GGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGACTTCCGACC
HKR420695 RBdS051M07 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR430102 RBdS075E06 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR430208 RBdS075I16 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR430236 RBdS075J20 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR432587 RBdS081H19 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR442236 RBdS105J20 pGCAP10 NM_000987.3  
GCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGA
HKR442285 RBdS105L21 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR444100 RBdS110E04 pGCAP10 NM_000987.3  
TTGCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCC
HKR444342 RBdS110O06 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR462627 RBdS156J11 pGCAP10 NM_000987.3  
GCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTT
HKR470926 RBdS177F06 pGCAP10 NM_000987.3  
GAGCAGCGTGTAGTTCTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl