Prev. |  KEGG KO K02877 > 

RIKEN DNA Bank Human Resource - RPL15

Gene ID NCBI Gene 6138 |  KEGG hsa:6138
Gene Symbol RPL15
Protein Name ribosomal protein L15
Synonyms DBA12|EC45|L15|RPL10|RPLY10|RPYL10
Ortholog resources KEGG ortholog (KEGG orthology K02877) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001369 IRAK003H01 pCMV-SPORT6 BC014837 NM_002948 Full/var
HGX066493 IRAK166D21 pCMV-SPORT6 BC071672 NM_002948 Full
HGY092608 IRAL031I16 pDNR-LIB BC030575 NM_002948 Partial
HGY100475 IRAL051D03 pDNR-LIB BC068198 NM_002948 Full
HGY103151 IRAL057O15 pDNR-LIB BC070328 NM_002948 Full
HGY103350 IRAL058G06 pOTB7 BC081565 NM_002948 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041677 ARe04D05 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR042053 ARe05C05 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR044503 ARe11E07 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR046876 ARe17D04 pKA1U5 NM_002948.2  
GCCTTTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATC
HKR047206 ARe18A06 pKA1U5 NM_002948.2  
AAGCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATC
HKR047722 ARe19F02 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAANATGGGTGCATACAAGTACATCCA
HKR050921 ARe27F01 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR052169 ARe30H01 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGATCTTTGCTCTTCCATC
HKR053732 ARe34F12 pKA1U5 NM_002948.2  
ATCCTGGCCTTTCCGTCTGGCGGCAGCCATCAGCTACCGCCAGCTCTCTGCTCTCCACAG
HKR055260 ARe38C12 pKA1U5 NM_002948.2  
GCGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGATCTTTGCTCTTCCATCCGCCTT
HKR056009 ARe40A09 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR056153 ARe40G09 pKA1U5 NM_002948.2  
AGCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCNTTATGGGTGCATACAAGTACATCC
HKR056826 ARe42B02 pKA1U5 NM_002948.2  
GGGGAGTACAGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTG
HKR056978 ARe42H10 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR058479 ARe46D07 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR058802 ARe47A02 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR058903 ARe47E07 pKA1U5 NM_002948.2  
GCCTTCCTTTCCGTCTGGCGGCAGCCATCAGGATAAGCCAAGATGGGTGCATACAAGTAC
HKR060079 ARe50D07 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGTTTGATTTCACAGGTAAGCCAAGATGGGTGCAT
HKR062459 ARe56C11 pKA1U5 NM_002948.2  
GCCTTTCCGCTCTGGCGGCAGCCATCAGGATAAGCCNATAAGGGNTGCATACAAGTACAT
HKR063377 ARe58H09 pKA1U5 NM_002948.2  
GGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCAGGAGCTA
HKR065652 ARe64C04 pKA1U5 NM_002948.2  
GCCCTTTCCGTCTGGCGGCAGCCATCAGGTTAAGCCAAGATGGGTGCATACAAGTACATC
HKR066030 ARe65B06 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR066407 ARe66A07 pKA1U5 NM_002948.2  
GCCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCC
HKR068081 ARe70D09 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAANATGGGTGCATACAAGTACATCCA
HKR068900 ARe72E04 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR069746 ARe74G02 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR072450 ARe81C02 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR074126 ARe85F06 pKA1U5 NM_002948.2  
GGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGATCTTTGCTCTTCCATCCGCCTTT
HKR075652 ARe89C04 pKA1U5 NM_002948.2  
GGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCAGGAGCTA
HKR077753 ARe94G09 pKA1U5 NM_002948.2  
GCCTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGCTAC
HKR078056 ARe95C08 pKA1U5 NM_002948.2  
GCCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCC
HKR078953 ARe97G09 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR080504 ARf01E08 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR082876 ARf07D04 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR162128 ARi05F08 pGCAP10 NM_002948.2  
GCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCAG
HKR163351 ARi08G07 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR165732 ARi14F12 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR167608 ARi19A08 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR168805 ARi22A05 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR168853 ARi22C05 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR171322 ARi28F02 pGCAP10 NM_002948.2  
GCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCAG
HKR172073 ARi30D01 pGCAP10 NM_002948.2  
GCCCTTTCCGTCTGGCGGCAGCCATCAGTACCGCCAGCTCTCTGCTCTCCACAGGGCTCC
HKR176083 ARi40D11 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR178001 ARi45A01 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR180477 ARi51D05 pGCAP10 NM_002948.2  
GGTGGGAGTACAGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGG
HKR183728 ARi59F08 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGATCTTTGCTCTTCCATC
HKR184525 ARi61F05 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR185706 ARi64E10 pGCAP10 NM_002948.2  
HKR187611 ARi69A11 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR188004 ARi70A04 pGCAP10 NM_002948.2  
GCCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCC
HKR188479 ARi71D07 pGCAP10 NM_002948.2  
GCCTTTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATC
HKR188551 ARi71G07 pGCAP10 NM_002948.2  
GCTTGCCTTCTGGCGGCAGCCATCATGTAAGCCAAGATGGGTGCATACTAGTACATCCTG
HKR203515 ARiS008N03 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR205349 ARiS013G05 pGCAP10 NM_002948.2  
GCTTTCCGTCTGGCNNCANCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCAG
HKR205360 ARiS013G16 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR205582 ARiS013P22 pGCAP10 NM_002948.2  
GCTTTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTA
HKR208060 ARiS020C12 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR208268 ARiS020L04 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR209409 ARiS023I17 pGCAP10 NM_002948.2  
CGGCCGGCCGATGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGG
HKR218025 ARiS045B01 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR218085 ARiS045D13 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR218103 ARiS045E07 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR218206 ARiS045I14 pGCAP10 NM_002948.2  
GCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCAG
HKR219626 ARiS049B02 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR219641 ARiS049B17 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR219646 ARiS049B22 pGCAP10 NM_002948.2  
TGGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGATCTTTGCTCTTCCATCCGCCTT
HKR219958 ARiS049O22 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR222229 ARiS055J13 pGCAP10 NM_002948.2  
GGTGGGAGTACAGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGG
HKR222270 ARiS055L06 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR222355 ARiS055O19 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR243694 ARiS109D22 pGCAP10 NM_002948.2  
GGGGAGTACAGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTG
HKR243704 ARiS109E08 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR243760 ARiS109G16 pGCAP10 NM_002948.2  
HKR260038 ARiS150B14 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR260065 ARiS150C17 pGCAP10 NM_002948.2  
GGGGAGTACNGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTG
HKR264758 ARiS161O22 pGCAP10 NM_002948.2  
GACAGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACA
HKR276448 ARiS191B24 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR277612 ARiS194A12 pGCAP10 NM_002948.2  
CGGCCGGCCGATGGGGAGTACAGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAG
HKR279378 ARiS198H10 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR321625 RBb04B01 pKA1U5 NM_002948.2  
GCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGATAAGCCAAGATGGGTGCATACAAGCTA
HKR324008 RBb10A08 pKA1U5 NM_002948.2  
TTTTTTGCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTA
HKR324101 RBb10E05 pKA1U5 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR327684 RBb19D12 pKA1U5 NM_002948.2  
GCCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCC
HKR328010 RBb20A10 pKA1U5 NM_002948.2  
GCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCAG
HKR329236 RBb23B12 pGCAP1 NM_002948.2  
HKR330145 RBb25G01 pGCAP1 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR330433 RBb26B09 pGCAP1 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR332952 RBb32G08 pGCAP1 NM_002948.2  
GCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCAG
HKR333355 RBb33G11 pGCAP1 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR339727 RBb49F07 pGCAP1 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR340479 RBb51D07 pGCAP1 NM_002948.2  
GGTGGGAGTACAGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGG
HKR340525 RBb51F05 pGCAP1 NM_002948.2  
TGTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATC
HKR341322 RBb53F02 pGCAP1 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGATCTTTGCTCTTCCATC
HKR341326 RBb53F06 pGCAP1 NM_002948.2  
TTGGGGGAGTACAGNNTCTTTCCTTTCCGTCTGGNGGCACCCCTAANAAGAGGCTGCGTT
HKR361684 RBd04D12 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGATCTTTGCTCTTCCATC
HKR362969 RBd07H01 pGCAP10 NM_002948.2  
GCCGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGATCTTTGCTCTTCCATCCGCCT
HKR366809 RBd17A09 pGCAP10 NM_002948.2  
GGTGGGAGTACAGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGG
HKR370877 RBd27D05 pGCAP10 NM_002948.2  
GCTTTTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATC
HKR374012 RBd35A12 pGCAP10 NM_002948.2  
GCTTTTTCCGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGATCTTTGCTCTTCCAT
HKR376451 RBd41C03 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGATCTTTGCTCTTCCATC
HKR376830 RBd42B06 pGCAP10 NM_002948.2  
CGGCCGGCCGATGCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATA
HKR378176 RBd45H08 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR379206 RBd48A06 pGCAP10 NM_002948.2  
GCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCAG
HKR380455 RBd51C07 pGCAP10 NM_002948.2  
GGGGAGTACAGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTG
HKR381307 RBd53E11 pGCAP10 NM_002948.2  
GCCTTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCC
HKR381659 RBd54C11 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGNTCTTTGCTCTTCCATC
HKR382050 RBd55C02 pGCAP10 NM_002948.2  
GGTGGGAGTACAGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCNNNNAAGCCAAGATGGG
HKR384055 RBd60C07 pGCAP10 NM_002948.2  
GCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCAG
HKR384555 RBd61G11 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR386012 RBd65A12 pGCAP10 NM_002948.2  
GCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCAG
HKR386411 RBd66A11 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGATCTTTGCTCTTCCATC
HKR387771 RBd69H03 pGCAP10 NM_002948.2  
GGGGAGTACAGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTG
HKR387778 RBd69H10 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR389305 RBd73E09 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR390151 RBd75G07 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGATCTTTGCTCTTCCATC
HKR405547 RBdS013O11 pGCAP10 NM_002948.2  
TATGCCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACA
HKR405977 RBdS014P17 pGCAP10 NM_002948.2  
TGCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCC
HKR406096 RBdS015D24 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR408880 RBdS022D08 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR416029 RBdS040B05 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR416113 RBdS040E17 pGCAP10 NM_002948.2  
CGGCCGGCCGATGGGGAGTACAGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAG
HKR420685 RBdS051L21 pGCAP10 NM_002948.2  
GGGGGGAGTACAGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGG
HKR430306 RBdS075M18 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR430351 RBdS075O15 pGCAP10 NM_002948.2  
GCTTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR432439 RBdS081B15 pGCAP10 NM_002948.2  
TGCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCC
HKR432669 RBdS081L05 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGATCTTTGCTCTTCCATC
HKR432780 RBdS081P20 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAGGCTGCGTTGAGGATCTTTGCTCTTCCATC
HKR441613 RBdS104A13 pGCAP10 NM_002948.2  
GGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCAGGAGCTA
HKR441845 RBdS104K05 pGCAP10 NM_002948.2  
GCCTTTTTTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTAC
HKR442369 RBdS105P09 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR452947 RBdS132G03 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR453147 RBdS132O11 pGCAP10 NM_002948.2  
GCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCA
HKR462620 RBdS156J04 pGCAP10 NM_002948.2  
GGGGAGTACAGCTCTTTCCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTG
HKR474973 RBdS187H05 pGCAP10 NM_002948.2  
GCTTTCCGTCTGGCGGCAGCCATCAGGTAAGCCAAGATGGGTGCATACAAGTACATCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl