Prev. |  KEGG KO K02925 > 

RIKEN DNA Bank Human Resource - RPL3

Gene ID NCBI Gene 6122 |  KEGG hsa:6122
Gene Symbol RPL3
Protein Name ribosomal protein L3
Synonyms ASC-1|L3|TARBP-B
Ortholog resources KEGG ortholog (KEGG orthology K02925) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007864 IRAK019K24 pCMV-SPORT6 BC013674 NM_000967 Full
HGX011764 IRAK029G20 pCMV-SPORT6 BC033296 NM_000967 Full/var
HGX053628 IRAK134B04 pCMV-SPORT6 BC063662 NM_000967 Full
HGY080716 IRAL001N04 pOTB7 BC002408 NM_000967 Full
HGY085214 IRAL013A14 pOTB7 BC004323 NM_000967 Partial
HGY088748 IRAL021O12 pDNR-LIB BC008492 NM_000967 Full/var
HGY089308 IRAL023E12 pOTB7 BC008003 NM_000967 Full
HGY089464 IRAL023K24 pOTB7 BC022790 NM_000967 Partial
HGY090216 IRAL025I24 pOTB7 BC012786 NM_000967 Full
HGY091425 IRAL028J09 pOTB7 BC014017 NM_000967 Full
HGY091642 IRAL029B18 pOTB7 BC012146 NM_000967 Full
HGY093767 IRAL034G23 pOTB7 BC015767 NM_000967 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006579 W01A016H11 pENTR-TOPO IRAL021O12 BC008492 NM_000967  
HGE006581 W01A016H13 pENTR-TOPO IRAL021O12 BC008492 NM_000967  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040554 ARe01G10 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR043354 ARe08G10 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR043605 ARe09A05 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR044577 ARe11H09 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR045604 ARe14A04 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR046012 ARe15A12 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR046453 ARe16C05 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR047771 ARe19H03 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR050081 ARe25D09 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR051627 ARe29B03 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR054501 ARe36E05 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR059276 ARe48D04 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR059675 ARe49D03 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR059754 ARe49G10 pKA1U5 NM_000967.3  
GACCGGCGGGATTTGATGGCGTGATGTCTCACANAAAGTTCTCCGCTCCCAGACATGGGT
HKR064882 ARe62D10 pKA1U5 NM_000967.3  
CTGGACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACATG
HKR069346 ARe73G02 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACNNAAAGTTCTCCGCTCCCAGACAT
HKR072827 ARe82B03 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR076572 ARe91H04 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR077706 ARe94E10 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR077755 ARe94G11 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR078553 ARe96G09 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR161201 ARi03A01 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR161725 ARi04F05 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR162409 ARi06A09 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGANNGTTCTCCGCTCCCAGACAT
HKR163324 ARi08F04 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR164425 ARi11B01 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR166451 ARi16C03 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGANGTTCTCCGCTCCAGACATGN
HKR167347 ARi18G03 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR169746 ARi24G02 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR170836 ARi27B12 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR171708 ARi29E12 pGCAP10 NM_000967.3  
GACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACATGGGT
HKR174830 ARi37B06 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR175371 ARi38H03 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR176860 ARi42C12 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR177301 ARi43E05 pGCAP10 NM_000967.3  
CGGCCGGCCGATGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCC
HKR178801 ARi47A01 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR179673 ARi49D01 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR181376 ARi53H08 pGCAP10 NM_000967.3  
TTTTTTTTTTTTTTTTTTTTTTTGTTTTGGTTTTTTTTAAAGTTCTCCGCTCCCAGACAT
HKR184836 ARi62B12 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR185379 ARi63H11 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR186897 ARi67E01 pGCAP10 NM_000967.3  
CGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACA
HKR205336 ARiS013F16 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR205505 ARiS013M17 pGCAP10 NM_000967.3  
AAGCTCNNNNGGCNGNNTTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGAC
HKR208263 ARiS020K23 pGCAP10 NM_000967.3  
CGGCCGGCCGATGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCC
HKR209334 ARiS023F14 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR218319 ARiS045N07 pGCAP10 NM_000967.3  
GCTCTACCGNCNGNATTTGATGGCNTGATGTCTCACAAAAAGTTCTCCGCTCCCAGACAT
HKR219705 ARiS049E09 pGCAP10 NM_000967.3  
TGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACA
HKR219908 ARiS049M20 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR222073 ARiS055D01 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR222129 ARiS055F09 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR222147 ARiS055G03 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR222225 ARiS055J09 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR234302 ARiS085M14 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR234917 ARiS087E21 pGCAP10 NM_000967.3  
GCTCTACCNGNNGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR235062 ARiS087K22 pGCAP10 NM_000967.3  
CGGCCGGCCGATGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCC
HKR238653 ARiS096K13 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR247228 ARiS118B04 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR247496 ARiS118M08 pGCAP10 NM_000967.3  
GCTCTACCNGCGGGATTTGATGGCGTGATGTCTCACANAAAGTTCTCCGCTCCCAGACAT
HKR248974 ARiS122H06 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR260219 ARiS150J03 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTNGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR276587 ARiS191H19 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR277749 ARiS194G05 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR320831 RBb02B07 pKA1U5 NM_000967.3  
GCTNTACCGCGCNGNCATTTGATGGCGCTGATGATCTCACANAAAGTTCGTCCGCCTCCC
HKR320900 RBb02E04 pKA1U5 NM_000967.3  
AGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACA
HKR322499 RBb06E03 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACNNTAAAGTTCTCCGCTCCCAGACA
HKR324031 RBb10B07 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR325778 RBb14H10 pKA1U5 NM_000967.3  
GACCGGCGGGATTTGATGGCGCTGATGTCTCACAGCAAAGTTCTCCGCGTCCCAGACATG
HKR326836 RBb17B12 pKA1U5 NM_000967.3  
GACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACATGGGT
HKR328172 RBb20H04 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR328405 RBb21A05 pKA1U5 NM_000967.3  
TTGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGAC
HKR328411 RBb21A11 pKA1U5 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR329254 RBb23C06 pGCAP1 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR330460 RBb26C12 pGCAP1 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR335635 RBb39B11 pGCAP1 NM_000967.3  
TGGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGAC
HKR336928 RBb42F08 pGCAP1 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR337283 RBb43D11 pGCAP1 NM_000967.3  
CTGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGAC
HKR338429 RBb46B05 pGCAP1 NM_000967.3  
AATGTGTGCTNTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCC
HKR341378 RBb53H10 pGCAP1 NM_000967.3  
TGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACA
HKR342084 RBb55D12 pGCAP1 NM_000967.3  
TGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACA
HKR342530 RBb56F10 pGCAP1 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR342932 RBb57F12 pGCAP1 NM_000967.3  
GCGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGAC
HKR345369 RBb63H01 pGCAP1 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGGGTGATGTCTCACAAAAAGTTCTCCGCTCCCAGACAT
HKR346146 RBb65G02 pGCAP1 NM_000967.3  
GCCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACA
HKR346406 RBb66A06 pGCAP1 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR360451 RBd01C03 pGCAP10 NM_000967.3  
HKR361609 RBd04A09 pGCAP10 NM_000967.3  
GAGATTTGGCTTTATATAGCGGACCCGTAAGGCCGACCGGCCTCTACCGGCGGGATTTGA
HKR363253 RBd08C05 pGCAP10 NM_000967.3  
TGTGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGA
HKR364484 RBd11D12 pGCAP10 NM_000967.3  
TGCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACATG
HKR366857 RBd17C09 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR366975 RBd17H07 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR371351 RBd28G07 pGCAP10 NM_000967.3  
GACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACATGGGT
HKR376126 RBd40F06 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR380849 RBd52C01 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR381276 RBd53D04 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR383746 RBd59G02 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR385680 RBd64D08 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR388153 RBd70G09 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR394945 RBd87G01 pGCAP10 NM_000967.3  
GGGCCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGA
HKR398179 RBd95H11 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR398426 RBd96B02 pGCAP10 NM_000967.3  
ACTCTTAGGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTC
HKR398570 RBd96H02 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR405329 RBdS013F09 pGCAP10 NM_000967.3  
TGCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACA
HKR406225 RBdS015J09 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR408860 RBdS022C12 pGCAP10 NM_000967.3  
GACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACATGGGT
HKR408901 RBdS022E05 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR420518 RBdS051E22 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR432647 RBdS081K07 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR432693 RBdS081M05 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR433244 RBdS083B20 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR441727 RBdS104F07 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR442013 RBdS105A13 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR442199 RBdS105I07 pGCAP10 NM_000967.3  
GACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACATGGGT
HKR444191 RBdS110H23 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR453059 RBdS132K19 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT
HKR471037 RBdS177J21 pGCAP10 NM_000967.3  
GCTCTACCGGCGGGATTTGATGGCGTGATGTCTCACAGAAAGTTCTCCGCTCCCAGACAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl