Prev. |  KEGG KO K06174 > 

RIKEN DNA Bank Human Resource - ABCE1

Gene ID NCBI Gene 6059 |  KEGG hsa:6059
Gene Symbol ABCE1
Protein Name ATP binding cassette subfamily E member 1
Synonyms ABC38|OABP|RLI|RLI1|RNASEL1|RNASELI|RNS4I
Ortholog resources KEGG ortholog (KEGG orthology K06174) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006107 IRAK015E11 pCMV-SPORT6 BC016283 NM_002940 Full/var
HGX010872 IRAK027C24 pCMV-SPORT6 BC016988 NM_002940 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168131 ARi20F11 pGCAP10 NM_002940.2  
GGCCATTTTGGCCGGTGGCCGTGAGAACACGCTGTGTGGCTGAAAAGTGAAGGCAAGAGC
HKR276546 ARiS191G02 pGCAP10 NM_002940.2  
GGCTTGCGCGTGCGGCGGCTGGGCACCGCCATTTTGGCCGGTGGCCGTGAGAACACGCTG
HKR322503 RBb06E07 pKA1U5 NM_002940.2  
GAGATGGGCCTAGGCTCCCAGCCTGCATCTTTCTCCTGAGCTGGATGCCTCCTGCCCTTG
HKR343283 RBb58D11 pGCAP1 NM_002940.2  
GGCGCGTGCGGCGGCTGGGCACCGCCATTTTGGCCGGTGGCCGTGAGAACACGCTGTGTG
HKR416072 RBdS040C24 pGCAP10 NM_002940.2  
GGCGGCTGGGCACCGCCATTTTGGCCGGTGGCCGTGAGAACACGCTGTGTGGCTGAAAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl