Prev. |  KEGG KO K16634 > 

RIKEN DNA Bank Human Resource - RNH1

Gene ID NCBI Gene 6050 |  KEGG hsa:6050
Gene Symbol RNH1
Protein Name ribonuclease/angiogenin inhibitor 1
Synonyms RAI|RNH
Ortholog resources KEGG ortholog (KEGG orthology K16634) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004867 IRAK012C19 pCMV-SPORT6 BC011500 NM_203389 Full
HGX007714 IRAK019E18 pCMV-SPORT6 BC011186 NM_203389 Partial
HGX039397 IRAK098I05 pCMV-SPORT6 BC047730 NM_203389 Full
HGY082184 IRAL005H16 pOTB7 BC000677 NM_203389 Full/var
HGY084134 IRAL010F14 pOTB7 BC014629 NM_203389 Full
HGY085297 IRAL013E01 pOTB7 BC003506 NM_203389 Full/var
HGY085345 IRAL013G01 pOTB7 BC024037 NM_203389 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043707 ARe09E11 pKA1U5 NM_002939.3  
ATCCTGGCCGTTCGCCTCAGCTACAACAAATCATCGTCAACCTGTTCCACCTTCTCCAGT
HKR050497 ARe26E01 pKA1U5 NM_002939.3  
GGCGGAGCGGCTCTGGCCTTGGGTCTGCGGCGGCGGCGTCGGAATCTCCGGCCTGTGAAA
HKR054524 ARe36F04 pKA1U5 NM_002939.3  
ACAACAAATCATCGTCAACCTGTTTCCACCTTCTCCAGTCTGGTAGCAAAAAGGGGTGTC
HKR061355 ARe53G11 pKA1U5 NM_002939.3  
GGGGTGTGTTCCAAAGTTTTGAGGACGGCCGAGCGGCGCTCCAAAACCCGTCCTCACAGC
HKR068876 ARe72D04 pKA1U5 NM_002939.3  
ATCCTGGGCGCCGCTGACTGGCGGGTGGGGTTGTCGACACGATTCAACCCGTTCTGCTGG
HKR070952 ARe77G08 pKA1U5 NM_002939.3  
GGTCCTCACAGCCTCGCCCCGNTTCGCCTCAGCTNCNTNAAATCATCGTCAACCTGTTCC
HKR160552 ARi01G08 pGCAP10 NM_002939.3  
GACGCCCGCGCCGCTGACTGGCGGGTGGGGTTGTCGACACGTTCAACCCGTTCTGCTGGC
HKR164974 ARi12H06 pGCAP10 NM_002939.3  
GAGCTCAGGCATGAAGAACTCTTGACTGACAGAAACGGAGGGTGTGTCCAAAGTTTTGAG
HKR173675 ARi34D03 pGCAP10 NM_002939.3  
GGCCGGCTCGAACACGCCCGCGCCGCTGACTGGCGGGTGGGGTTGTCGACACGTTCAACC
HKR174482 ARi36D10 pGCAP10 NM_002939.3  
TGGTTCGCCTCAGCTACAACAAATCATCGTCAACCTGTTCCACCTTCTCCAGTCTGGTAG
HKR179331 ARi48F11 pGCAP10 NM_002939.3  
GGACGACACCTTCAACCCGTTCTGCTGGCTCGAGAACGAAGGGGGCCGTCTCGCTCTGGG
HKR185769 ARi64H01 pGCAP10 NM_002939.3  
HKR209211 ARiS023A11 pGCAP10 NM_002939.3  
GGTCCTCACAGCCTCGCCCCGTTCGCCTCAGCTACAACAAATCATCGTCAACCTGTTCCA
HKR209497 ARiS023M09 pGCAP10 NM_002939.3  
GGCGCCGCTGACTGGCGGGTGGGGTTGTCGACACGTTCAACCCGTTCTGCTGGCTCGAGA
HKR219804 ARiS049I12 pGCAP10 NM_002939.3  
GGCCTCAGCTACAACAAATCATCGTCAACCTGTTCCACCTTCTCCAGTCTGGTAGCAAAA
HKR247515 ARiS118N03 pGCAP10 NM_002939.3  
TGGGGGTTGTCGACNCNTTCAACCCGTTCTGCTGGCTCGAGAACGAAGTAGGCCGTCTCG
HKR264604 ARiS161I12 pGCAP10 NM_002939.3  
GCCCGTTCGCCTCAGCTACAACAAATCATCGTCAACCTGTTCCACCTTCTCCAGTCTGGT
HKR276553 ARiS191G09 pGCAP10 NM_002939.3  
GGCGCCGCTGACTGGCGGGTGGGGTTGTCGACACGTTCAACCCGTTCTGCTGGCTCGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.06.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl