Prev. |  KEGG KO K10666 > 

RIKEN DNA Bank Human Resource - RNF5

Gene ID NCBI Gene 6048 |  KEGG hsa:6048
Gene Symbol RNF5
Protein Name ring finger protein 5
Synonyms RING5|RMA1
Ortholog resource in our bank

  RNF5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081117 IRAL002N05 pOTB7 BC004155 NM_006913 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182546 ARi56G02 pGCAP10 NM_006913.3  
GACGACTGAAGGGTACGTGGGGCGAAACAAAACCGGCCATGGCAGCAGCGGAGGAGGAGG
HKR260294 ARiS150M06 pGCAP10 NM_006913.3  
CGGCCGGCCGATATTTGGGGGGACTGAAGGGTACGTGGGGCGAAACAAAACCGGCCATGG
HKR260382 ARiS150P22 pGCAP10 NM_006913.3  
CGGCCGGCCGATATTTGGGGGGACTGAAGGGTACGTGGGGCGAAACAAAACCGGCCATGG
HKR381750 RBd54G06 pGCAP10 NM_006913.3  
GGCCCAACGATCGTGGGCAGGAGGTGGTTTCTGGTTTGTTGGGGNGTGTGTATGTGTATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl