Prev. |  KEGG KO K05255 > 

RIKEN DNA Bank Human Resource - RLN2

Gene ID NCBI Gene 6019 |  KEGG hsa:6019
Gene Symbol RLN2
Protein Name relaxin 2
Synonyms H2|H2-RLX|RLXH2|bA12D24.1.1|bA12D24.1.2
Ortholog resources KEGG ortholog (KEGG orthology K05255) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR470870 RBdS177C22 pGCAP10 NM_005059.2  
CGGCCGGCCGATGACTCAGCCGTGGCTGGTCCCTAAAGTTTGGGCTTTTCCTTTGCCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl