Prev. |  KEGG KO K07208 > 

RIKEN DNA Bank Human Resource - RHEB

Gene ID NCBI Gene 6009 |  KEGG hsa:6009
Gene Symbol RHEB
Protein Name Ras homolog, mTORC1 binding
Synonyms RHEB2
Ortholog resources KEGG ortholog (KEGG orthology K07208) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005725 IRAK014F05 pCMV-SPORT6 BC009638 NM_005614 Full
HGY067183 IRAK167P23 pBluescriptR BC066307 NM_005614 Full/var
HGY083305 IRAL008E09 pOTB7 BC016155 NM_005614 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064547 ARe61G03 pKA1U5 NM_005614.3  
GGCGCCCGCCGCCGCCCCTGCTCTGTATGCCGCCCTTTACCGGCGCGGCCGCCGCCGATC
HKR208079 ARiS020D07 pGCAP10 NM_005614.3  
GGCCGCGCGGTCGGTTCCGGGCGGTTGGGAGCGCGCGAGCTAGCGAGCGAGAGGCAGCCG
HKR218099 ARiS045E03 pGCAP10 NM_005614.3  
GAGCGAGCGAGAGGCAGCCGCGCCCGCCGCCGCCCCTGCTCTGTATGCCGCTCTCTCCCG
HKR222122 ARiS055F02 pGCAP10 NM_005614.3  
GATCGCGGCGTCCCCTTTTTTTGCCTTTAAAGTAAAACGTCGCCCCGACGCACCCCCCGC
HKR279416 ARiS198I24 pGCAP10 NM_005614.3  
HKR334827 RBb37B03 pGCAP1 NM_005614.3  
TAGTCGTGACTTTTCTGGGGGCATCGCGGCGTCCCCTTTTTTTGCCTTTAAAGTAAAACG
HKR384834 RBd62B10 pGCAP10 NM_005614.3  
CGGCCGGCCGATGGGTTCCGGGCGGTTGGGAGCGCGCGAGCTAGCGAGCGAGAGGCAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl