Prev. |  KEGG KO K12009 > 

RIKEN DNA Bank Human Resource - TRIM27

Gene ID NCBI Gene 5987 |  KEGG hsa:5987
Gene Symbol TRIM27
Protein Name tripartite motif containing 27
Synonyms RFP|RNF76
Ortholog resource in our bank

  TRIM27

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005967 IRAK014P07 pCMV-SPORT6 BC013580 NM_006510 Full
HGY066966 IRAK167G22 pBluescriptR BC066924 NM_006510 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR336874 RBb42D02 pGCAP1 NM_006510.4  
TGGGTCTTGCGCGCTTTGCCCGCCTGGCCCTGGGACTCTGACCCTCGGCTACCCTTTCCT
HKR377652 RBd44C04 pGCAP10 NM_006510.4  
GGCTCGCGCTGGGGTGGGGTTTACGCTGCCGCCGGCATCCGCTCGGACGCGGCCACGTTG
HKR432531 RBdS081F11 pGCAP10 NM_006510.4  
GGCTGCCGCCGGCATCCGCTCGGACGCGGCCACGTTGTCTTGCGCGCTTTGCCCGCCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl