Prev. |  KEGG KO K09253 > 

RIKEN DNA Bank Human Resource - RELB

Gene ID NCBI Gene 5971 |  KEGG hsa:5971
Gene Symbol RELB
Protein Name RELB proto-oncogene, NF-kB subunit
Synonyms I-REL|IMD53|IREL|REL-B
Ortholog resources KEGG ortholog (KEGG orthology K09253) in the DNA Bank
Featured content NF-kappa B signaling pathway (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX024995 IRAK062I03 pCMV-SPORT6 BC028013 NM_006509 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172879 ARi32D07 pGCAP10 NM_006509.2  
TGGCCCGCCCGGCCCGGCCCCGCGCCCCGCGCAGCCCCGGGCGCCGCGCGTCCTGCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl