Prev. |  KEGG KO K05762 > 

RIKEN DNA Bank Human Resource - RDX

Gene ID NCBI Gene 5962 |  KEGG hsa:5962
Gene Symbol RDX
Protein Name radixin
Synonyms DFNB24
Ortholog resource in our bank

  RDX

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036554 IRAK091G10 pBluescript BC047109 NM_002906 Full/var
HGY084809 IRAL012A09 pOTB7 BC002626 NM_002906
HGY096659 IRAL041K19 pDNR-LIB BC029467 NM_002906

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068522 ARe71F02 pKA1U5 NM_002906.3  
GGCCTTTTCCCGCGGAGGCGCCGAGCGGCCATATTGCGGAGCTGTCTGCGGTGGCGGCGG
HKR165702 ARi14E06 pGCAP10 NM_002906.3  
ATTGCGGAGCTGTCTGCGGTGGCGGCGGCGCCTCTCGTCTCCCGCGGCCCAGCGCTCGCA
HKR373602 RBd34A02 pGCAP10 NM_002906.3  
CATATTGCGGAGCTGTCTGCGGTGGCGGCGGCGCCTCTCGTCTCCCGCGGCCCAGCGCTC
HKR385207 RBd63A07 pGCAP10 NM_002906.3  
TTGGTCTGCGGTGGCGGCGGCGCCTCTCGTCTCCCGCGGCCCAGCGCTCGCACCACCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl