Prev. | 

RIKEN DNA Bank Human Resource - RBP3

Gene ID NCBI Gene 5949 |  KEGG hsa:5949
Gene Symbol RBP3
Protein Name retinol binding protein 3
Synonyms D10S64|D10S65|D10S66|IRBP|RBPI|RP66
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033780 IRAK084H12 pCMV-SPORT6 BC039844 NM_002900 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080837 M01C002B13 pDONR221 04-134-2_1-G07 BC039844 NM_002900  
HGE080885 M01C002D13 pDONR221 04-134-2_1-G07 BC039844 NM_002900  
HGE080933 M01C002F13 pDONR221 04-134-2_1-G07 BC039844 NM_002900  
HGE080981 M01C002H13 pDONR221 04-134-2_1-G07 BC039844 NM_002900  
HGE081029 M01C002J13 pDONR221 04-134-2_1-G07 BC039844 NM_002900  
HGE081077 M01C002L13 pDONR221 04-134-2_1-G07 BC039844 NM_002900  
HGE081125 M01C002N13 pDONR221 04-134-2_1-G07 BC039844 NM_002900  
HGE081173 M01C002P13 pDONR221 04-134-2_1-G07 BC039844 NM_002900  
HGE094444 M01C036B20 pDONR221 MGC07-H10 BC039844 NM_002900  
HGE094492 M01C036D20 pDONR221 MGC07-H10 BC039844 NM_002900  
HGE094540 M01C036F20 pDONR221 MGC07-H10 BC039844 NM_002900  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR376176 RBd40H08 pGCAP10 NM_002900.3 full/var  
GAGCTGAGAAGGACAAGGGCGGAAGGCAGCTGCACAGAGCAGGGCCACGGCCTTGCACAC
HKR402956 RBdS007G12 pGCAP10 NM_002900.2  
TTGAGACCTTCTGTCCACCAGCTGAGAAGGACAAGGGCGGAAGGCAGCTGCACAGAGCAG
HKR428363 RBdS070P03 pGCAP10 NM_002900.2  
GAGACCTTCTGTCCACCNGCTGAGAAGGACAAGGGCGGAAGGCAGCTGCACAGAGCAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl