Prev. |  KEGG KO K14961 > 

RIKEN DNA Bank Human Resource - RBBP5

Gene ID NCBI Gene 5929 |  KEGG hsa:5929
Gene Symbol RBBP5
Protein Name RB binding protein 5, histone lysine methyltransferase complex subunit
Synonyms RBQ3|SWD1
Ortholog resource in our bank

  RBBP5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046125 IRAK115F05 pCMV-SPORT6 BC053856 NM_005057 Full
HGY019024 IRAK047J08 pBluescriptR BC037284 NM_005057 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095244 M01C038B20 pDONR221 MGC08-H10 BC053856 NM_005057  
HGE095292 M01C038D20 pDONR221 MGC08-H10 BC053856 NM_005057  
HGE095340 M01C038F20 pDONR221 MGC08-H10 BC053856 NM_005057  
HGE095388 M01C038H20 pDONR221 MGC08-H10 BC053856 NM_005057  
HGE095436 M01C038J20 pDONR221 MGC08-H10 BC053856 NM_005057  
HGE095484 M01C038L20 pDONR221 MGC08-H10 BC053856 NM_005057  
HGE095532 M01C038N20 pDONR221 MGC08-H10 BC053856 NM_005057  
HGE095580 M01C038P20 pDONR221 MGC08-H10 BC053856 NM_005057  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182100 ARi55E04 pGCAP10 NM_005057.2  
GGTCCACCACTTAGACGCAAGTTGCTGAAGCCGGCCGGGGAGAAGGTGTTGTTGCCGGAG
HKR395771 RBd89H03 pGCAP10 NM_005057.2  
GGCGCGGCGTCCACCACTTAGACGCAAGTTGCTGAAGCCGGCCGGGGAGAAGGTGTTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl