Prev. |  KEGG KO K10044 > 

RIKEN DNA Bank Human Resource - RARRES2

Gene ID NCBI Gene 5919 |  KEGG hsa:5919
Gene Symbol RARRES2
Protein Name retinoic acid receptor responder 2
Synonyms HP10433|TIG2
Ortholog resources KEGG ortholog (KEGG orthology K10044) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083035 IRAL007J19 pOTB7 BC000069 NM_002889 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042459 ARe06C11 pKA1U5 NM_002889.3  
GGAGACCTCCAGGCGCAGGGAAGGACGGCCAGGGTGACACGGAAGCATGCGACGGCTGCT
HKR053229 ARe33B05 pKA1U5 NM_002889.3  
GGAGGCCAAGATTTCAGCTGCGGGACGGTCAGGGGAGACCTCCAGGCGCAGGGAAGGACG
HKR054031 ARe35B07 pKA1U5 NM_002889.3  
GAGAGCGGGAAGAGGCGGACAGCGAGGCCAAGATTTCAGCTGCGGGACGGTCAGGGGAGA
HKR060432 ARe51B08 pKA1U5 NM_002889.3  
GAGCTGCGGGACGGTCAGGGGAGACCTCCAGGCGCAGGGAAGGACGGCCAGGGTGACACG
HKR064850 ARe62C02 pKA1U5 NM_002889.3  
GGAGAAGAAGAGCGGGAAGAGGCGGACAGCGAGGCCAAGATTTCAGCTGCGGGACGGTCA
HKR066932 ARe67F12 pKA1U5 NM_002889.3  
GCCAAGATTTCAGCTGCGGGACGGTCAGGGGAGACCTCCAGGCGCAGGGAAGGACGGCCA
HKR068055 ARe70C07 pKA1U5 NM_002889.3  
GGGACAGCGAGGCCAAGATTTCAGCTGCGGGACGGTCAGGGGAGACCTCCAGGCGCAGGG
HKR081354 ARf03G10 pKA1U5 NM_002889.3  
GAGAGTTGCCTGGAGGGGGTCCAGGAGGTGGGGGTGGGAGGAGGTGGGGGCCGCCCCGCG
HKR166054 ARi15C06 pGCAP10 NM_002889.3  
GGATTTCAGCTGCGGGACGGTCAGGGGAGACCTCCAGGCGCAGGGAAGGACGGCCAGGGT
HKR171330 ARi28F10 pGCAP10 NM_002889.3  
ACAGGAGGTGGGGGCCGCCCCGCGAGAAGAAGAGCGGGAAGAGGCGGACAGCGAGGCCAA
HKR175349 ARi38G05 pGCAP10 NM_002889.3  
GGAGAAGAAGAGCGGGAAGAGGCGGACAGCGAGGCCAAGATTTCAGCTGCGGGACGGTCA
HKR176954 ARi42G10 pGCAP10 NM_002889.3  
CGGCCGGACGATTCATTTTATGTTTCAAGTTCAGGGGGAGGTGTGGGAGGTTAGACCTCC
HKR178572 ARi46H04 pGCAP10 NM_002889.3  
GAGAGTTGCTGGAGGGGGTCCAGGAGGTGGGGGTGGGAGGAGGTGGGGGCCGCCCCGCGA
HKR187255 ARi68C07 pGCAP10 NM_002889.3  
GAGCGGGAAGAGGCGGACAGCGAGGCCAAGATTTCAGCTGCGGGACGGTCAGGGGAGACC
HKR205216 ARiS013A16 pGCAP10 NM_002889.3  
GGGACAGCGAGGCCAAGATTTCAGCTGCGGGACGGTCAGGGGAGACCTCCAGGCGCAGGG
HKR208081 ARiS020D09 pGCAP10 NM_002889.3  
GGAAGAGCGGGAAGAGGCGGACAGCGAGGCCAAGATTTCAGCTGCGGGACGGTCAGGGGA
HKR209267 ARiS023C19 pGCAP10 NM_002889.3  
AGCTGCGGGACGGTCAGGGGAGACCTCCAGGCGCAGGGAAGGACGGCCAGGGTGACACGG
HKR235115 ARiS087N03 pGCAP10 NM_002889.3  
HKR235158 ARiS087O22 pGCAP10 NM_002889.3  
GGCCGCCCCGCGAGAAGAANAGCGGGAAGAGGCGGACAGCGAGGCCAAGATTTCAGCTGC
HKR235416 ARiS088I24 pGCAP10 NM_002889.3  
AGAAGAGCGGGAAGAGGCGGACAGCGAGGCCAAGATTTCAGCTGCGGGACGGTCAGGGGA
HKR276575 ARiS191H07 pGCAP10 NM_002889.3  
GGCCAAGATTTCAGCTGCGGGACGGTCAGGGGAGACCTCCAGGCGCAGGGAAGGACGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl