Prev. |  KEGG KO K14319 > 

RIKEN DNA Bank Human Resource - RANGAP1

Gene ID NCBI Gene 5905 |  KEGG hsa:5905
Gene Symbol RANGAP1
Protein Name Ran GTPase activating protein 1
Synonyms Fug1|RANGAP|SD
Ortholog resource in our bank

  RANGAP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011781 IRAK029H13 pCMV-SPORT6 BC019676 NM_002883 Partial
HGY030252 IRAK075K12 pBluescriptR BC041396 NM_002883 Full
HGY042664 IRAK106K24 pBluescript BC048990 NM_002883 Full
HGY083866 IRAL009L02 pOTB7 BC004990 NM_002883 Partial
HGY091230 IRAL028B06 pOTB7 BC014044 NM_002883 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE015836 W01A039J20 pENTR-TOPO IRAL028B06 BC014044 NM_002883  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR380947 RBd52G03 pGCAP10 NM_002883.2  
GGGCTTTCAAAATCCTCCTCCTCCGCCATCATCCGCCGCGGTGCGGAGAGCAGGTGGTGC
HKR405239 RBdS013B15 pGCAP10 NM_002883.2  
GATCATCCGCCGCGGTGCGGAGAGCAGGTGGTGCTGGAAGCGCGTGAGGCCGGGAGCTCG
HKR430344 RBdS075O08 pGCAP10 NM_002883.2  
TGGCCATCATCCGCCGCGGTGCGGAGAGCAGGTGGTGCTGGAAGCGCGTGAGGCCGGGAG
HKR444282 RBdS110L18 pGCAP10 NM_002883.2  
GGCCGCGGTGCGGAGAGCAGGTGGTGCTGGAAGCGCGTGAGGCCGGGAGCTCGAGAGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl