Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RAD52

Gene ID (NCBI) 5893
Gene Symbol RAD52
Protein Name RAD52 homolog, DNA repair protein
Synonyms -
Databases KEGG hsa:5893 |  NCBI Gene 5893
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10873)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR243873 ARiS109L09 pGCAP10 NM_134424.2  
GATAGCCTAGATCGAGCTCCCTGTGTGCACCGCGCGCTGCCCGAGGCGCAGGTCAACCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl