Prev. |  KEGG KO K10873 > 

RIKEN DNA Bank Human Resource - RAD52

Gene ID NCBI Gene 5893 |  KEGG hsa:5893
Gene Symbol RAD52
Protein Name RAD52 homolog, DNA repair protein
Synonyms -
Ortholog resource in our bank

  RAD52

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243873 ARiS109L09 pGCAP10 NM_134424.2  
GATAGCCTAGATCGAGCTCCCTGTGTGCACCGCGCGCTGCCCGAGGCGCAGGTCAACCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl