Prev. |  KEGG KO K08830 > 

RIKEN DNA Bank Human Resource - MOK

Gene ID NCBI Gene 5891 |  KEGG hsa:5891
Gene Symbol MOK
Protein Name MOK protein kinase
Synonyms RAGE|RAGE-1|RAGE1|STK30
Ortholog resource in our bank

  MOK

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046061 IRAK115C13 pCMV-SPORT6 BC053536 NM_014226 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050452 ARe26C04 pKA1U5 NM_014226.1  
GACACAGATAAAATGTGTCTCCTTCGTCTCTACTAGAGAGGAAAAAGAACTGGAATTGGA
HKR055755 ARe39G11 pKA1U5 NM_014226.1  
TTTGACTGGTGCTGGAGTTTTGAGTCCACAGATAAAATGTGTCTCCTTCGTCTCTACTAG
HKR188548 ARi71G04 pGCAP10 NM_014226.1  
GAGGAAAAAGAACTGGAATTGGAAGAACAGGGAGACTGAAGGGTAGCAAGAGAGGCTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl