Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RAD51C

Gene ID (NCBI) 5889
Gene Symbol RAD51C
Protein Name RAD51 paralog C
Synonyms BROVCA3|FANCO|R51H3|RAD51L2
Databases KEGG hsa:5889 |  NCBI Gene 5889
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10870)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05437 pAxCALNLhRAD51C (forward) Shuttle vector to generate rAd harboring human RAD51C (forward)
RDB05438 pAxCALNLhRAD51C (reverse) Shuttle vector to generate rAd harboring human RAD51C (reverse)

RDB_org_170226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR063232 ARe58B08 pKA1U5 NM_058216.1  
GGAGCCTGCGATGCGCGGGAAGACGTTCCGCTTTGAAATGCAGCGGGATTTGGTGAGTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl