RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - RAD51C

Gene ID	NCBI Gene 5889 \| KEGG hsa:5889
Gene Symbol	RAD51C
Protein Name	RAD51 paralog C
Synonyms	BROVCA3\|FANCO\|R51H3\|RAD51L2

Ortholog resource in our bank

  RAD51C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB05437	pAxCALNLhRAD51C (forward)	Shuttle vector to generate rAd harboring human RAD51C (forward)
RDB05438	pAxCALNLhRAD51C (reverse)	Shuttle vector to generate rAd harboring human RAD51C (reverse)

webcatalog20220516.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR063232	ARe58B08	pKA1U5	NM_058216.1
HKR063232	GGAGCCTGCGATGCGCGGGAAGACGTTCCGCTTTGAAATGCAGCGGGATTTGGTGAGTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl