Prev. |  KEGG KO K06109 > 

RIKEN DNA Bank Human Resource - RAB13

Gene ID NCBI Gene 5872 |  KEGG hsa:5872
Gene Symbol RAB13
Protein Name RAB13, member RAS oncogene family
Synonyms GIG4
Ortholog resources KEGG ortholog (KEGG orthology K06109) in the DNA Bank
Featured content Rab Family - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX069926 IRAK174N14 pCMV-SPORT6 BC073168 NM_002870 Full
HGX001797 IRAK004I05 pCMV-SPORT6 BC000799 NM_002870
HGY090240 IRAL025J24 pOTB7 BC009227 NM_002870 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047775 ARe19H07 pKA1U5 NM_002870.2  
GTCTTCCTGGCCTGGGCTCCGTGCCGCTCTGTTTGCCAACCGNTCCAGTCCCGCCTACCA
HKR048506 ARe21E10 pKA1U5 NM_002870.2  
GCCCCACCCCTCCCCCGGCTCCCCCGGTGTCCGCCATGGCCAAAGCCTACGACCACCTCT
HKR170826 ARi27B02 pGCAP10 NM_002870.2  
GCTGTTTGCCAACCGTCCAGTCCCGCCTACCAGTGCCGGGCGCTCCCCACCCCTCCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl