Prev. |  KEGG KO K07887 > 

RIKEN DNA Bank Human Resource - RAB5A

Gene ID NCBI Gene 5868 |  KEGG hsa:5868
Gene Symbol RAB5A
Protein Name RAB5A, member RAS oncogene family
Synonyms RAB5
Ortholog resources KEGG ortholog (KEGG orthology K07887) in the DNA Bank
Featured content Endocytosis (human)
Featured content Rab Family - human
Featured content Amyotrophic lateral sclerosis (ALS) - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001838 IRAK004J22 pCMV-SPORT6 BC001267 NM_004162 Full
HGX007675 IRAK019D03 pCMV-SPORT6 BC018288 NM_004162 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR203312 ARiS008E16 pGCAP10 NM_004162.4  
GAGCGGAAGTGGCTCCGGCGGTGGGACTTGAGTGTTTGTGTTTTGGTTCGTGAAGGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl