Prev. |  KEGG KO K07877 > 

RIKEN DNA Bank Human Resource - RAB2A

Gene ID NCBI Gene 5862 |  KEGG hsa:5862
Gene Symbol RAB2A
Protein Name RAB2A, member RAS oncogene family
Synonyms LHX|RAB2
Ortholog resources KEGG ortholog (KEGG orthology K07877) in the DNA Bank
Featured content Rab Family - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081259 IRAL003C11 pOTB7 BC008929 NM_002865 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024435 W01A061B11 pENTR-TOPO IRAL003C11 BC008929 NM_002865  
HGE024439 W01A061B15 pENTR-TOPO IRAL003C11 BC008929 NM_002865  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040970 ARe02H02 pKA1U5 NM_002865.1  
AGAACTTCCGGGTCGGCGCGGAGGCGGGGCGGACGCTCCGCGGCGGCTGTTATTGTTCGG
HKR169232 ARi23B08 pGCAP10 NM_002865.1  
GATTGTTCGGCTGGGCTCGGTCGGGCGCTGTCTCCCTCGGCTCTGCGGGTGTCAGTTCGT
HKR175604 ARi39A04 pGCAP10 NM_002865.1  
GGAGGCGGGGCGGAGGCGCCGCGGCGGCTGTTATTGTTCGGCTGGGCTCGGTCGGGCGCT
HKR243786 ARiS109H18 pGCAP10 NM_002865.1  
GGTGTGCCCTGGCACTGAGCGGCCGCGGCCATGGCGTACGCCTATCTCTTCAAGTACATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl