Prev. |  KEGG KO K12657 > 

RIKEN DNA Bank Human Resource - ALDH18A1

Gene ID NCBI Gene 5832 |  KEGG hsa:5832
Gene Symbol ALDH18A1
Protein Name aldehyde dehydrogenase 18 family member A1
Synonyms ADCL3|ARCL3A|GSAS|P5CS|PYCS|SPG9|SPG9A|SPG9B
Ortholog resources KEGG ortholog (KEGG orthology K12657) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062575 ARe56H07 pKA1U5 NM_002860.3  
GGGCGTGGAAGCTGCGGCACCCGACGGTTANNTGCCANCCCCTTNAAAGGCGGCGGTGGT
HKR074525 ARe86F05 pKA1U5 NM_002860.3  
GGGCGTGGAGTGCGGACCCGCGGTAGTGCCAGGGGGCGAAGGCGGCGGTGGTGAGGAAGA
HKR264590 ARiS161H22 pGCAP10 NM_002860.3  
GGTGGACGGAAGAAAAAAGANAGTGAGCGAGCGCCGGAATCAGCCCGGCGTGGAGTGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl