Prev. |  KEGG KO K00286 > 

RIKEN DNA Bank Human Resource - PYCR1

Gene ID NCBI Gene 5831 |  KEGG hsa:5831
Gene Symbol PYCR1
Protein Name pyrroline-5-carboxylate reductase 1
Synonyms ARCL2B|ARCL3B|P5C|P5CR|PIG45|PP222|PRO3|PYCR
Ortholog resources KEGG ortholog (KEGG orthology K00286) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011023 IRAK027J07 pCMV-SPORT6 BC022244 NM_006907 Partial
HGY083119 IRAL007N07 pOTB7 BC001504 NM_006907 Full
HGY103340 IRAL058F20 pOTB7 BC071842 NM_006907 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR205573 ARiS013P13 pGCAP10 NM_006907.2  
GGCGGGTGCCGCGTGGCGGCCGCAGCGCTGAGGGAGCCGGTGCCATCTGTGGGGGCTTTG
HKR341611 RBb54A11 pGCAP1 NM_006907.2  
GCCCGCGCACGGTAGCTGGGTTGGGAGCCGGTGCCATCTGTGGGGGCTTTGGGCCAGGGG
HKR360921 RBd02F01 pGCAP10 NM_006907.2  
GGGGCGGGGTTTGGGTGCGGGTGCCGCGTGGCGGCCGCAGCGCTGAGGGGTGGAGCCGGT
HKR364478 RBd11D06 pGCAP10 NM_006907.2  
GGTGGCGGCCGCAGCGCTGAGGGAGCCGGTGCCATCTGTGGGGGCTTTGGGCCAGGGGTC
HKR366932 RBd17F12 pGCAP10 NM_006907.2  
GGGGTGCCGCGTGGCGGCCGCAGCGCTGAGGGAGCCGGTGCCATCTGTGGGGGCTTTGGG
HKR369633 RBd24B09 pGCAP10 NM_006907.2  
GGGGGCCAATTCGAGCTGGAGACTGTGGCCGGCTGGGGGGATGTGGGCCTGGGGTCTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl