Prev. |  KEGG KO K13342 > 

RIKEN DNA Bank Human Resource - PEX5

Gene ID NCBI Gene 5830 |  KEGG hsa:5830
Gene Symbol PEX5
Protein Name peroxisomal biogenesis factor 5
Synonyms PBD2A|PBD2B|PTS1-BP|PTS1R|PXR1|RCDP5
Ortholog resource in our bank

  PEX5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE016166 W01A040G22 pENTR-TOPO IRAK013M05 BC010621 NM_000319  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR176502 ARi41E06 pGCAP10 NM_000319.4  
GCCCTCCCCCAAGCCAGCACCTGGTGCCCCGGCGGGTCGTGCGGCGCGGCGCTCGGCGAG
HKR388828 RBd72B04 pGCAP10 NM_000319.4  
GGCGGCGCTCGGCGGTGAGCGCCTGACCCCGAGGGCCGGGCCCTCCCCACCCTTGCGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl