Prev. |  KEGG KO K05760 > 

RIKEN DNA Bank Human Resource - PXN

Gene ID NCBI Gene 5829 |  KEGG hsa:5829
Gene Symbol PXN
Protein Name paxillin
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K05760) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008344 IRAK020O08 pCMV-SPORT6 BC015217 NM_002859 Partial/var
HGY098992 IRAL047H24 pOTB7 BC052611 NM_002859
HGY084639 IRAL011J23 pOTB7 BC003647 NM_002859 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045676 ARe14D04 pKA1U5 NM_002859.2  
GTCCGGGACCTAGGCTCGCGGCGGAAAAGTTGCCNNTNATAGNACAAGCGGCCCCGGGAC
HKR079607 ARe99A07 pKA1U5 NM_002859.2  
TTTCCTGGGGACTTACTCACCGAGTGAAAGCACCCCGCTGCGGATTAGATTACCTCTGCT
HKR187605 ARi69A05 pGCAP10 NM_002859.2  
GCCGTTCCGGGCCGAGGCTCGCGGCGGAAAAGTTGCGGGGCATAGACGAGCGGCCCCGGG
HKR205243 ARiS013B19 pGCAP10 NM_002859.2  
GGGGCNNGGGCGCGCGCGGCGGCGGCGCGTTCCGTTCCGGGCCGAGGCTCGCGGCGGAAA
HKR249080 ARiS122L16 pGCAP10 NM_002859.2  
TGGGGCCGAGGCTCGCGGCGGAAAAGTTGCGGGGCATAGACGAGCGGCCCCGGGACGGGC
HKR276512 ARiS191E16 pGCAP10 NM_002859.2  
GGCGGCGGGCGCGGGCGCGGGCGCGCGCGGCGGCGGCGCGTTCCGTTCCGGGCCGAGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl