Prev. |  KEGG KO K02830 > 

RIKEN DNA Bank Human Resource - RAD1

Gene ID NCBI Gene 5810 |  KEGG hsa:5810
Gene Symbol RAD1
Protein Name RAD1 checkpoint DNA exonuclease
Synonyms HRAD1|REC1
Ortholog resource in our bank

  RAD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001240 IRAK003B16 pCMV-SPORT6 BC006837 NM_133377 Full
HGY087723 IRAL019F03 pDNR-LIB BC009804 NM_133377 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE017350 W01A043G06 pENTR-TOPO IRAK003B16 BC006837 NM_133377  
HGE017354 W01A043G10 pENTR-TOPO IRAK003B16 BC006837 NM_133377  
HGE017358 W01A043G14 pENTR-TOPO IRAK003B16 BC006837 NM_133377  
HGE017360 W01A043G16 pENTR-TOPO IRAK003B16 BC006837 NM_133377  
HGE017394 W01A043I02 pENTR-TOPO IRAK003B16 BC006837 NM_133377  
HGE017400 W01A043I08 pENTR-TOPO IRAK003B16 BC006837 NM_133377  
HGE017408 W01A043I16 pENTR-TOPO IRAK003B16 BC006837 NM_133377  
HGE017416 W01A043I24 pENTR-TOPO IRAK003B16 BC006837 NM_133377  
HGE017448 W01A043K08 pENTR-TOPO IRAK003B16 BC006837 NM_133377  
HGE017462 W01A043K22 pENTR-TOPO IRAK003B16 BC006837 NM_133377  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR327654 RBb19C06 pKA1U5 NM_002853.3  
GGAGGTGGAGGGCCGGTCTGAAGAGTGGCGGGACTGGCTTCACTTCCTCCGCGGTTCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl