Prev. |  KEGG KO K16667 > 

RIKEN DNA Bank Human Resource - PTPRG

Gene ID NCBI Gene 5793 |  KEGG hsa:5793
Gene Symbol PTPRG
Protein Name protein tyrosine phosphatase receptor type G
Synonyms HPTPG|PTPG|R-PTP-GAMMA|RPTPG
Ortholog resources KEGG ortholog (KEGG orthology K16667) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR279507 ARiS198M19 pGCAP10 NM_002841.3  
GACATGTTACTTCCTGTATGGAGGCATGGCCAGTTTCCAGCCCCGCGCTCTTCGTTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl